National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11987R-1 
 Symbol tgo  Full Name tango 
 CG No CG11987  Old CG No CG11987 
 Synonyms Arnt, ARNT, HIF-1beta, Hif1, TGO, dARNT, DARNT, arnt, Tango, darnt, HIF-1, prd7, HIF1b, CG11987, tgo, Tgo 
 Accession No (Link to NCBI) NM_169254.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Adachi-Yamada T, Harumoto T, Sakurai K, Ueda R, Saigo K, O'Connor MB, Nakato H.
Wing-to-Leg homeosis by spineless causes apoptosis regulated by Fish-lips, a novel leucine-rich repeat transmembrane protein.
Mol. Cell. Biol. (2005) 25(8) 3140-50 [ PubMed ID = 15798200 ] [ RRC reference ]

Tajiri R, Tsuji T, Ueda R, Saigo K, Kojima T.
Fate determination of Drosophila leg distal regions by trachealess and tango through repression and stimulation, respectively, of Bar homeobox gene expression in the future pretarsus and tarsus.
Dev. Biol. (2007) 303(2) 461-73 [ PubMed ID = 17187773 ] [ RRC reference ]

Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATACAGGACAAGGAGCGGTTC 
 Primer Seq. 3'
aatctagaggtaccCCCTCCTTTTTCACAGTTCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATACAGGACA AGGAGCGGTT CgNCAGCCGC gAGAACCATT GCGAGATTGA ACGACGTCGC 
0061 CGCAACAAGA TGACGGCCTA CATCACGGAA CTCTCGGACA TGGTGCCCAC CTGCAGTGCC 
0121 CTGGCCCGCA AACCGGACAA GCTCACCATT CTCCGCATGG CAGTGGCTCA CATGAAGGCA 
0181 CTGCGTGGCA CAGGAAATAC CAGCAGCGAT GGCACTTACA AGCCCTCCTT CCTGACCGAC 
0241 CAGGAGCTTA AGCATCTTAT CCTGGAGGCG GCCGATGGTT TCCTGTTCGT GGTATCCTGC 
0301 GACTCGGGCA GGGTGATCTA TGTATCGGAT TCGGTGACTC CCGTGCTGAA CTACACCCAA 
0361 AGCGATTGGT ATGGCACTAG CCTGTATGAG CACATCCATC CCGATGATCG CGAGAAGATC 
0421 CGCGAGCAAT TATCAACCCA GGAATCGCAG AATGCCGGCC GCATCCTGGA TCTAAAGTCG 
0481 GGAACTGTGA AAAAGGAGGG  
 in silico PCR Fragment
0001 ATACAGGACA AGGAGCGGTT CGCCAGCCGC GAGAACCATT GCGAGATTGA ACGACGTCGC 
0061 CGCAACAAGA TGACGGCCTA CATCACGGAA CTCTCGGACA TGGTGCCCAC CTGCAGTGCC 
0121 CTGGCCCGCA AACCGGACAA GCTCACCATT CTCCGCATGG CAGTGGCTCA CATGAAGGCA 
0181 CTGCGTGGCA CAGGAAATAC CAGCAGCGAT GGCACTTACA AGCCCTCCTT CCTGACCGAC 
0241 CAGGAGCTTA AGCATCTTAT CCTGGAGGCG GCCGATGGTT TCCTGTTCGT GGTATCCTGC 
0301 GACTCGGGCA GGGTGATCTA TGTATCGGAT TCGGTGACTC CCGTGCTGAA CTACACCCAA 
0361 AGCGATTGGT ATGGCACTAG CCTGTATGAG CACATTCATC CCGATGATCG CGAGAAGATC 
0421 CGCGAGCAAT TATCAACCCA GGAATCGCAG AATGCCGGCC GCATCCTGGA TCTAAAGTCG 
0481 GGAACTGTGA AAAAGGAGGG  
 Assemble Data

11987R-1.IR_full       1   ATACAGGACAAGGAGCGGTTCGNCAGCCGCGAGAACCATTGCGAGATTGAACGACGTCGC 60
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
11987R-1.in silico     1   ATACAGGACAAGGAGCGGTTCGCCAGCCGCGAGAACCATTGCGAGATTGAACGACGTCGC 60


11987R-1.IR_full       61  CGCAACAAGATGACGGCCTACATCACGGAACTCTCGGACATGGTGCCCACCTGCAGTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     61  CGCAACAAGATGACGGCCTACATCACGGAACTCTCGGACATGGTGCCCACCTGCAGTGCC 120


11987R-1.IR_full       121 CTGGCCCGCAAACCGGACAAGCTCACCATTCTCCGCATGGCAGTGGCTCACATGAAGGCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     121 CTGGCCCGCAAACCGGACAAGCTCACCATTCTCCGCATGGCAGTGGCTCACATGAAGGCA 180


11987R-1.IR_full       181 CTGCGTGGCACAGGAAATACCAGCAGCGATGGCACTTACAAGCCCTCCTTCCTGACCGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     181 CTGCGTGGCACAGGAAATACCAGCAGCGATGGCACTTACAAGCCCTCCTTCCTGACCGAC 240


11987R-1.IR_full       241 CAGGAGCTTAAGCATCTTATCCTGGAGGCGGCCGATGGTTTCCTGTTCGTGGTATCCTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     241 CAGGAGCTTAAGCATCTTATCCTGGAGGCGGCCGATGGTTTCCTGTTCGTGGTATCCTGC 300


11987R-1.IR_full       301 GACTCGGGCAGGGTGATCTATGTATCGGATTCGGTGACTCCCGTGCTGAACTACACCCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     301 GACTCGGGCAGGGTGATCTATGTATCGGATTCGGTGACTCCCGTGCTGAACTACACCCAA 360


11987R-1.IR_full       361 AGCGATTGGTATGGCACTAGCCTGTATGAGCACATCCATCCCGATGATCGCGAGAAGATC 420
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
11987R-1.in silico     361 AGCGATTGGTATGGCACTAGCCTGTATGAGCACATTCATCCCGATGATCGCGAGAAGATC 420


11987R-1.IR_full       421 CGCGAGCAATTATCAACCCAGGAATCGCAGAATGCCGGCCGCATCCTGGATCTAAAGTCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11987R-1.in silico     421 CGCGAGCAATTATCAACCCAGGAATCGCAGAATGCCGGCCGCATCCTGGATCTAAAGTCG 480


11987R-1.IR_full       481 GGAACTGTGAAAAAGGAGGG 500
                           ||||||||||||||||||||
11987R-1.in silico     481 GGAACTGTGAAAAAGGAGGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169254.1  CG11987-RA (tgo), mRNA 
0   NM_079444.2  CG8727-RA (cyc), mRNA 
0   NM_142042.2  CG10841-RA (CG10841), mRNA 
0   NM_141927.1  CG17793-RA (CG17793), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_142985.1  CG5715-RA (CG5715), mRNA 
0   NM_080119.3  CG6143-RB, transcript variant B (Pep), mRNA 
0   NM_206396.1  CG6143-RC, transcript variant C (Pep), mRNA 
0   NM_168742.2  CG6143-RA, transcript variant A (Pep), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_139971.1  CG6915-RA (CG6915), mRNA 
0   NM_132435.1  CG1582-RA (CG1582), mRNA 
0   NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   NM_001043083.1  CG34123-RB, transcript variant B (CG34123), mRNA 
0   NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
0   NM_142606.2  CG10889-RA (CG10889), mRNA 
0   NM_170272.1  CG32849-RA (Hex-t2), mRNA 
0   NM_132562.1  CG12720-RA (CG12720), mRNA 
0   NM_142330.1  CG5225-RA (CG5225), mRNA 
0   NM_170448.1  CG31038-RB, transcript variant B (CG31038), mRNA 
0   NM_170449.2  CG31038-RD, transcript variant D (CG31038), mRNA 
0   NM_206585.1  CG31038-RE, transcript variant E (CG31038), mRNA 
0   NM_206584.1  CG31038-RF, transcript variant F (CG31038), mRNA 
0   NM_170447.1  CG31038-RA, transcript variant A (CG31038), mRNA 
0   NM_167441.2  CG9176-RB, transcript variant B (cngl), mRNA 
0   NM_078608.3  CG9176-RC, transcript variant C (cngl), mRNA 
0   NM_166025.1  CG13349-RB, transcript variant B (CG13349), mRNA 
0   NM_137073.2  CG13349-RA, transcript variant A (CG13349), mRNA 
0   NM_206586.1  CG31038-RC, transcript variant C (CG31038), mRNA 
0   NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.