National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11912R-2 
 Symbol CG11912  Full Name CG11912 
 CG No CG11912  Old CG No CG11912 
 Synonyms SP140, anon-WO0140519.112, CG11912 
 Accession No (Link to NCBI) NM_134673.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCGGTTATATTCGCACTGG 
 Primer Seq. 3'
aatctagaggtaccAGCAATCCTGAGTTGTCGCGG 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 TCGCGGTTAT ATTCGCACTG GCTCTGGcTT CGGTTTCGGC NATTTCTGTC CCTCAGCCGG 
0061 GATTCCCCGA AGGTCGCATC ATCAACGGCT ATGAAGCGGC GAAGGGAGAG GCGCCCTATA 
0121 TTGTGTCCTT ACAGACCACA TCCAACTCGC ACTTCTGTGC AGGAAGCTTG CTCGATGAGG 
0181 TGACCATTGT GACCGCCGCA CACTGCCTGA CCTACAATCA GGGTCAgGCA GTTGCCGGTG 
0241 CACACAGCCG CACTGACCAG GAGAACGTTC AGATTAGGAA GTTCACCAAT GCCCAGTACG 
0301 TGATCCACGA GAACTACGGT GGCGGTGTGG GACCCAACGA CATCGGCCTA ATTCTCCTCA 
0361 AGGAAGAGGA TGCCTTTGAC CTGAATGCCG TTGCCCGTGA TGGCAGCAAT CCGGTTTCCG 
0421 CAGTAAGTCT TCCTTCAAAG ACATTCCAAG GCACTAGCGA TGGATATCTG TAcgNCTgGG 
0481 GCCGCGACAA CTCAGGATTG CT 
 in silico PCR Fragment
0001 TCGCGGTTAT ATTCGCACTG GCTCTGGCTT CGGTTTCGGC CATTTCTGTC CCTCAGCCGG 
0061 GATTCCCCGA AGGTCGCATC ATCAACGGCT ATGAAGCGGC GAAGGGAGAG GCGCCCTATA 
0121 TTGTGTCCTT ACAGACCACA TCCAACTCGC ACTTCTGTGC AGGAAGCTTG CTCGATGAGG 
0181 TGACCATTGT GACCGCCGCA CACTGCCTGA CCTACAATCA GGGTCAGGCA GTTGCCGGTG 
0241 CACACAGCCG CACTGACCAG GAGAACGTTC AGATTAGGAA GTTCACCAAT GCCCAGTACG 
0301 TGATCCACGA GAACTACGGT GGCGGTGTGG GACCCAACGA CATCGGCCTA ATTCTCCTCA 
0361 AGGAAGAGGA TGCCTTTGAC CTGAATGCCG TTGCCCGTGA TGGCAGCAAT CCGGTTTCCG 
0421 CAGTAAGTCT TCCTTCAAAG ACATTCCAAG GCACTAGCGA TGGATATCTG TACGGCTGGG 
0481 GCCGCGACAA CTCAGGATTG CT 
 Assemble Data

11912R-2.IR_full       1   TCGCGGTTATATTCGCACTGGCTCTGGCTTCGGTTTCGGCNATTTCTGTCCCTCAGCCGG 60
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
11912R-2.in silico     1   TCGCGGTTATATTCGCACTGGCTCTGGCTTCGGTTTCGGCCATTTCTGTCCCTCAGCCGG 60


11912R-2.IR_full       61  GATTCCCCGAAGGTCGCATCATCAACGGCTATGAAGCGGCGAAGGGAGAGGCGCCCTATA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     61  GATTCCCCGAAGGTCGCATCATCAACGGCTATGAAGCGGCGAAGGGAGAGGCGCCCTATA 120


11912R-2.IR_full       121 TTGTGTCCTTACAGACCACATCCAACTCGCACTTCTGTGCAGGAAGCTTGCTCGATGAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     121 TTGTGTCCTTACAGACCACATCCAACTCGCACTTCTGTGCAGGAAGCTTGCTCGATGAGG 180


11912R-2.IR_full       181 TGACCATTGTGACCGCCGCACACTGCCTGACCTACAATCAGGGTCAGGCAGTTGCCGGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     181 TGACCATTGTGACCGCCGCACACTGCCTGACCTACAATCAGGGTCAGGCAGTTGCCGGTG 240


11912R-2.IR_full       241 CACACAGCCGCACTGACCAGGAGAACGTTCAGATTAGGAAGTTCACCAATGCCCAGTACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     241 CACACAGCCGCACTGACCAGGAGAACGTTCAGATTAGGAAGTTCACCAATGCCCAGTACG 300


11912R-2.IR_full       301 TGATCCACGAGAACTACGGTGGCGGTGTGGGACCCAACGACATCGGCCTAATTCTCCTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     301 TGATCCACGAGAACTACGGTGGCGGTGTGGGACCCAACGACATCGGCCTAATTCTCCTCA 360


11912R-2.IR_full       361 AGGAAGAGGATGCCTTTGACCTGAATGCCGTTGCCCGTGATGGCAGCAATCCGGTTTCCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11912R-2.in silico     361 AGGAAGAGGATGCCTTTGACCTGAATGCCGTTGCCCGTGATGGCAGCAATCCGGTTTCCG 420


11912R-2.IR_full       421 CAGTAAGTCTTCCTTCAAAGACATTCCAAGGCACTAGCGATGGATATCTGTACGNCTGGG 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
11912R-2.in silico     421 CAGTAAGTCTTCCTTCAAAGACATTCCAAGGCACTAGCGATGGATATCTGTACGGCTGGG 480


11912R-2.IR_full       481 GCCGCGACAACTCAGGATTGCT 502
                           ||||||||||||||||||||||
11912R-2.in silico     481 GCCGCGACAACTCAGGATTGCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_134673.2  CG11912-RA (CG11912), mRNA 
0   NM_138066.2  CG15873-RA (CG15873), mRNA 
0   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   NM_130556.2  CG14785-RA (CG14785), mRNA 
0   NM_168525.1  CG10948-RA, transcript variant A (CG10948), mRNA 
0   NM_168524.1  CG10948-RC, transcript variant C (CG10948), mRNA 
0   NM_140349.2  CG10948-RB, transcript variant B (CG10948), mRNA 
0   NM_001043234.1  CG12946-RB, transcript variant B (CG12946), mRNA 
0   NM_141687.1  CG12946-RA, transcript variant A (CG12946), mRNA 
0   NM_142017.2  CG8774-RA, transcript variant A (CG8774), mRNA 
0   NM_169502.1  CG8774-RB, transcript variant B (CG8774), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_166652.1  CG13567-RA, transcript variant A (CG13567), mRNA 
0   NM_138030.1  CG13567-RB, transcript variant B (CG13567), mRNA 
0   17  41  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   15  NM_140083.1  CG18179-RA (CG18179), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.