National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11864R-2 
 Symbol CG11864  Full Name CG11864 
 CG No CG11864  Old CG No CG11864 
 Synonyms BACR44L22.8, BG:BACR44L22.8, CG11864 
 Accession No (Link to NCBI) NM_135912.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAGATATGGGGTGTGATTT 
 Primer Seq. 3'
aatctagaggtaccCCACTGGATGCTGACGTATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCAGATATG GGGTGTGATT TTTTTGTTCA CTCCTACTGT TTTTAGTGAA CTCTTTAAGG 
0061 ATCCGGAGCT GCTTGCCGGA TTTTATCAGG GGGACATAAA AGCTCATCCA ATTCGTACTC 
0121 GAAACGGAAT TGTCAATCAG ATTTATCACT GGCCCAATCG CACTGTACCA TATATGATTG 
0181 AAGATGATGC ATTTGCCGAC AGTCATTATC GGGAAATTCT TAGAGCCATT TCCATCATAG 
0241 AGGAAAACTC ATGCGTTATT TTCAAGCCAG CTACTGAAAT GGATTTTCCC ATGGCGCTCG 
0301 TCATTACGTC AAAAGGTTTG GGCTGCAATA CCGTTCACTT GGGCTATAGG AATAAGACAC 
0361 AGGTGGTAAA TCTGGAGATT TACCCACTTG GCGAAGGCTG CTTTCGCATC GGTTCCATTA 
0421 TCCACGAGCT CCTTCACGTT TTGGGCTTCG AACATCAGCA TGTGTCCCAA AATCGGGACC 
0481 AATACGTCAG CATCCAGTGG  
 in silico PCR Fragment
0001 CGCAGATATG GGGTGTGATT TTTTTGTTCA CTCCTACTGT TTTTAGTGAA CTCTTTAAGG 
0061 ATCCGGAGCT GCTTGCCGGA TTTTATCAGG GGGACATAAA AGCTCATCCA ATTCGTACTC 
0121 GAAACGGAAT TGTCAATCAG ATTTATCACT GGCCCAATCG CACTGTACCA TATATGATTG 
0181 AAGATGATGC ATTTGCCGAC AGTCATTATC GGGAAATTCT TAGAGCCATT TCCATCATAG 
0241 AGGAAAACTC ATGCGTTATT TTCAAGCCAG CTACTGAAAT GGATTTTCCC ATGGCGCTCG 
0301 TCATTACGTC AAAAGGTTTG GGCTGCAATA CCGTTCACTT GGGCTATAGG AATAAGACAC 
0361 AGGTGGTAAA TCTGGAGATT TACCCACTTG GCGAAGGCTG CTTTCGCATC GGTTCCATTA 
0421 TCCACGAGCT CCTTCACGTT TTGGGCTTCG AACATCAGCA TGTGTCCCAA AATCGGGACC 
0481 AATACGTCAG CATCCAGTGG  
 Assemble Data

11864R-2.IR_full       1   CGCAGATATGGGGTGTGATTTTTTTGTTCACTCCTACTGTTTTTAGTGAACTCTTTAAGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     1   CGCAGATATGGGGTGTGATTTTTTTGTTCACTCCTACTGTTTTTAGTGAACTCTTTAAGG 60


11864R-2.IR_full       61  ATCCGGAGCTGCTTGCCGGATTTTATCAGGGGGACATAAAAGCTCATCCAATTCGTACTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     61  ATCCGGAGCTGCTTGCCGGATTTTATCAGGGGGACATAAAAGCTCATCCAATTCGTACTC 120


11864R-2.IR_full       121 GAAACGGAATTGTCAATCAGATTTATCACTGGCCCAATCGCACTGTACCATATATGATTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     121 GAAACGGAATTGTCAATCAGATTTATCACTGGCCCAATCGCACTGTACCATATATGATTG 180


11864R-2.IR_full       181 AAGATGATGCATTTGCCGACAGTCATTATCGGGAAATTCTTAGAGCCATTTCCATCATAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     181 AAGATGATGCATTTGCCGACAGTCATTATCGGGAAATTCTTAGAGCCATTTCCATCATAG 240


11864R-2.IR_full       241 AGGAAAACTCATGCGTTATTTTCAAGCCAGCTACTGAAATGGATTTTCCCATGGCGCTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     241 AGGAAAACTCATGCGTTATTTTCAAGCCAGCTACTGAAATGGATTTTCCCATGGCGCTCG 300


11864R-2.IR_full       301 TCATTACGTCAAAAGGTTTGGGCTGCAATACCGTTCACTTGGGCTATAGGAATAAGACAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     301 TCATTACGTCAAAAGGTTTGGGCTGCAATACCGTTCACTTGGGCTATAGGAATAAGACAC 360


11864R-2.IR_full       361 AGGTGGTAAATCTGGAGATTTACCCACTTGGCGAAGGCTGCTTTCGCATCGGTTCCATTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     361 AGGTGGTAAATCTGGAGATTTACCCACTTGGCGAAGGCTGCTTTCGCATCGGTTCCATTA 420


11864R-2.IR_full       421 TCCACGAGCTCCTTCACGTTTTGGGCTTCGAACATCAGCATGTGTCCCAAAATCGGGACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11864R-2.in silico     421 TCCACGAGCTCCTTCACGTTTTGGGCTTCGAACATCAGCATGTGTCCCAAAATCGGGACC 480


11864R-2.IR_full       481 AATACGTCAGCATCCAGTGG 500
                           ||||||||||||||||||||
11864R-2.in silico     481 AATACGTCAGCATCCAGTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135912.2  CG11864-RA (CG11864), mRNA 
0   NM_135455.2  CG4389-RA, transcript variant A (CG4389), mRNA 
0   NM_164860.1  CG4389-RB, transcript variant B (CG4389), mRNA 
0   NM_164861.1  CG4389-RC, transcript variant C (CG4389), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_134311.2  CG9741-RC, transcript variant C (Dhod), mRNA 
0   NM_057876.3  CG9741-RA, transcript variant A (Dhod), mRNA 
0   NM_140809.2  CG3945-RA (Rad9), mRNA 
0   NM_164998.1  CG31860-RA (CG31860), mRNA 
0   NM_168784.1  CG32204-RA (CG32204), mRNA 
0   NM_130643.2  CG2854-RA (CG2854), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_136212.1  CG9323-RA (CG9323), mRNA 
0   NM_139635.1  CG15014-RA (CG15014), mRNA 
0   NM_137046.3  CG6191-RA (CG6191), mRNA 
0   NM_079384.2  CG4314-RA (st), mRNA 
0   NM_001032103.1  CG33678-RA (CG33678), mRNA 
0   NM_169751.1  CG31267-RA (CG31267), mRNA 
0   56  NM_168226.1  CG32377-RA (CG32377), mRNA 
0   11  NM_135911.1  CG15255-RA (CG15255), mRNA 
0   NM_138251.2  CG2277-RA (CG2277), mRNA 
0   NM_078521.2  CG32858-RC, transcript variant C (sn), mRNA 
0   NM_167142.1  CG32858-RA, transcript variant A (sn), mRNA 
0   NM_167143.1  CG32858-RB, transcript variant B (sn), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_139943.1  CG7201-RA (CG7201), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.