National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11842R-2 
 Symbol CG11842  Full Name CG11842 
 CG No CG11842  Old CG No CG11842 
 Synonyms SP68, CG11842 
 Accession No (Link to NCBI) NM_143405.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGCAGCGCGATCTTCGCC 
 Primer Seq. 3'
aatctagaggtaccCGTTGTAAATCGCCGGGTAGC 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 ATGAGCAGCG CGATCTTCgN CAAGATTGTC CAGCTGGGAG CAGTACTGCT GGTTTCATTC 
0061 GTCGCATGGG CGTCAGCTCA GGATCCGGAT ATAGCCAGGA CGTGCACTGC CTACAAGAAA 
0121 AGCGTTTGGA GAGGAGACGT CCGAGTTCAG CTTTCTGATC GAGAACGCTC CGATTATCTA 
0181 CAAGACCCTG GACAAATGCA CTAGCTATGC GCGCGCTCAT CATCGGCGGA GGACCCGCTG 
0241 TGCCCAAGGA GTTNCCCGCA TGCTGCGCGC CTGGGACACA AAGATGAGAA TGGCGAGGTG 
0301 GAATGGTTCT GTGGCGGAAC ACTTATCAGC GACAGACATG TgNTCACCGC AGCGCATTGC 
0361 CACTACTCAC CACAAGGATC AGTGAACATC GCGCGCCTCG GGGACCTGGA ATNCGACACC 
0421 AACAACGACG ATGCGGATCC GGAGGACTTC GATGTGAAGG ACTTCACCGC GCACCCCGAA 
0481 TTTAGCTACC CGGCGATTTA CAACG 
 in silico PCR Fragment
0001 ATGAGCAGCG CGATCTTCGC CAAGATTGTC CAGCTGGGAG CAGTATTGCT GGTTTCATTC 
0061 GTCGCATGGG CGTCAGCTCA GGATTCGGAT ATAGCCAGGA CGTGCACTGC CTACAAGAGA 
0121 AGCGTTTGG- GAGGAGACGT CCGAGTTCAG CTTTCTGATC GAGAACGCTC CGATTATCTA 
0181 CAAGACCCTG GACAAATGCA CTAGCTATGC GC-CGCTCAT CATCGGCGGA GGACCCGCCG 
0241 TGCCCAAGGA GTT-CCCGCA TGCTGCGCGC CTGGGACACA AAGATGAGAA TGGCGAGGTG 
0301 GAATGGTTCT GTGGCGGAAC ACTTATCAGC GACAGACATG TGCTCACCGC AGCGCATTGC 
0361 CACTACTCAC CACAAGGATC AGTGAACATC GCGCGCCTCG GGGACCTGGA ATTCGACACC 
0421 AACAACGACG ATGCGGATCC GGAGGACTTC GATGTGAAGG ACTTCACCGC GCACCCCGAA 
0481 TTTAGCTACC CGGCGATTTA CAACG 
 Assemble Data

11842R-2.IR_full       1   ATGAGCAGCGCGATCTTCGNCAAGATTGTCCAGCTGGGAGCAGTACTGCTGGTTTCATTC 60
                           ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||
11842R-2.in silico     1   ATGAGCAGCGCGATCTTCGCCAAGATTGTCCAGCTGGGAGCAGTATTGCTGGTTTCATTC 60


11842R-2.IR_full       61  GTCGCATGGGCGTCAGCTCAGGATCCGGATATAGCCAGGACGTGCACTGCCTACAAGAAA 120
                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
11842R-2.in silico     61  GTCGCATGGGCGTCAGCTCAGGATTCGGATATAGCCAGGACGTGCACTGCCTACAAGAGA 120


11842R-2.IR_full       121 AGCGTTTGGAGAGGAGACGTCCGAGTTCAGCTTTCTGATCGAGAACGCTCCGATTATCTA 180
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
11842R-2.in silico     121 AGCGTTTGG-GAGGAGACGTCCGAGTTCAGCTTTCTGATCGAGAACGCTCCGATTATCTA 180


11842R-2.IR_full       181 CAAGACCCTGGACAAATGCACTAGCTATGCGCGCGCTCATCATCGGCGGAGGACCCGCTG 240
                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
11842R-2.in silico     181 CAAGACCCTGGACAAATGCACTAGCTATGCGC-CGCTCATCATCGGCGGAGGACCCGCCG 240


11842R-2.IR_full       241 TGCCCAAGGAGTTNCCCGCATGCTGCGCGCCTGGGACACAAAGATGAGAATGGCGAGGTG 300
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
11842R-2.in silico     241 TGCCCAAGGAGTT-CCCGCATGCTGCGCGCCTGGGACACAAAGATGAGAATGGCGAGGTG 300


11842R-2.IR_full       301 GAATGGTTCTGTGGCGGAACACTTATCAGCGACAGACATGTGNTCACCGCAGCGCATTGC 360
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
11842R-2.in silico     301 GAATGGTTCTGTGGCGGAACACTTATCAGCGACAGACATGTGCTCACCGCAGCGCATTGC 360


11842R-2.IR_full       361 CACTACTCACCACAAGGATCAGTGAACATCGCGCGCCTCGGGGACCTGGAATNCGACACC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
11842R-2.in silico     361 CACTACTCACCACAAGGATCAGTGAACATCGCGCGCCTCGGGGACCTGGAATTCGACACC 420


11842R-2.IR_full       421 AACAACGACGATGCGGATCCGGAGGACTTCGATGTGAAGGACTTCACCGCGCACCCCGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11842R-2.in silico     421 AACAACGACGATGCGGATCCGGAGGACTTCGATGTGAAGGACTTCACCGCGCACCCCGAA 480


11842R-2.IR_full       481 TTTAGCTACCCGGCGATTTACAACG 505
                           |||||||||||||||||||||||||
11842R-2.in silico     481 TTTAGCTACCCGGCGATTTACAACG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_143405.1  CG11842-RA (CG11842), mRNA 
0.2   NM_135154.1  CG9227-RA (tectonic), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_176680.2  CG33082-RA (CG33082), mRNA 
0   NM_143728.2  CG14630-RA (CG14630), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_079363.3  CG7450-RA, transcript variant A (CrebA), mRNA 
0   NM_206374.1  CG7450-RB, transcript variant B (CrebA), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_136773.1  CG12343-RA (CG12343), mRNA 
0   NM_137219.2  CG8256-RC, transcript variant C (l(2)k05713), mRNA 
0   NM_166119.1  CG8256-RB, transcript variant B (l(2)k05713), mRNA 
0   NM_166118.1  CG8256-RA, transcript variant A (l(2)k05713), mRNA 
0   NR_001738.1  CR30082, mRNA 
0   10  NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   NM_143404.1  CG11841-RA (CG11841), mRNA 
0   NM_169602.1  CG7390-RB, transcript variant B (smp-30), mRNA 
0   NM_130672.2  CG2712-RA (CG2712), mRNA 
0   NM_079629.2  CG7390-RA, transcript variant A (smp-30), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_166592.1  CG30417-RA (CG30417), mRNA 
0   NM_170639.1  CG17122-RA (CG17122), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.