National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11842R-1 
 Symbol CG11842  Full Name CG11842 
 CG No CG11842  Old CG No CG11842 
 Synonyms SP68, CG11842 
 Accession No (Link to NCBI) NM_143405.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| silico     1   ATGAGCAGCGCGATCTTCGCCAAGATTGTCCAGCTGGGAGCAGTATTGCTGGTTTCATTC 60

                           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | silico     61  GTCGCATGGGCGTCAGCTCAGGATTCGGATATAGCCAGGACGTGCACTGCCTACAAGAGA 120

                           ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCGTTTGG-GAGGAGACGTCCGAGTTCAGCTTTCTGATCGAGAACGCTCCGATTATCTA 180

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | silico     181 CAAGACCCTGGACAAATGCACTAGCTATGCGC-CGCTCATCATCGGCGGAGGACCCGCCG 240

                           ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCCCAAGGAGTT-CCCGCATGCTGCGCGCCTGGGACACAAAGATGAGAATGGCGAGGTG 300

                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     301 GAATGGTTCTGTGGCGGAACACTTATCAGCGACAGACATGTGCTCACCGCAGCGCATTGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     361 CACTACTCACCACAAGGATCAGTGAACATCGCGCGCCTCGGGGACCTGGAATTCGACACC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACAACGACGATGCGGATCCGGAGGACTTCGATGTGAAGGACTTCACCGCGCACCCCGAA 480

11842R-1.IR_full       481 TTTAGCTACCCGGCGATTTACAACG 505
                           ||||||||||||||||||||||||| silico     481 TTTAGCTACCCGGCGATTTACAACG 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_143405.1  CG11842-RA (CG11842), mRNA 
0.2   NM_135154.1  CG9227-RA (tectonic), mRNA 
0   NM_137151.2  CG10212-RA (SMC2), mRNA 
0   NM_176680.2  CG33082-RA (CG33082), mRNA 
0   NM_143728.2  CG14630-RA (CG14630), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_079363.3  CG7450-RA, transcript variant A (CrebA), mRNA 
0   NM_206374.1  CG7450-RB, transcript variant B (CrebA), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_136773.1  CG12343-RA (CG12343), mRNA 
0   NM_137219.2  CG8256-RC, transcript variant C (l(2)k05713), mRNA 
0   NM_166119.1  CG8256-RB, transcript variant B (l(2)k05713), mRNA 
0   NM_166118.1  CG8256-RA, transcript variant A (l(2)k05713), mRNA 
0   NR_001738.1  CR30082, mRNA 
0   10  NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_057278.3  CG7727-RA (Appl), mRNA 
0   NM_143404.1  CG11841-RA (CG11841), mRNA 
0   NM_169602.1  CG7390-RB, transcript variant B (smp-30), mRNA 
0   NM_130672.2  CG2712-RA (CG2712), mRNA 
0   NM_079629.2  CG7390-RA, transcript variant A (smp-30), mRNA 
0   NM_176225.1  CG15086-RB, transcript variant B (CG15086), mRNA 
0   NM_176226.1  CG15086-RC, transcript variant C (CG15086), mRNA 
0   NM_176227.1  CG15086-RD, transcript variant D (CG15086), mRNA 
0   NM_137513.2  CG15086-RA, transcript variant A (CG15086), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_166592.1  CG30417-RA (CG30417), mRNA 
0   NM_170639.1  CG17122-RA (CG17122), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.