National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11841R-4 
 Symbol CG11841  Full Name CG11841 
 CG No CG11841  Old CG No CG11841 
 Synonyms SP45, BcDNA:GH26583, anon-WO0140519.6, anon-WO0140519.18, CG11841 
 Accession No (Link to NCBI) NM_143404.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCATGCAATCGCTAGAA 
 Primer Seq. 3'
aatctagaggtaccTCATTGTAGAGTTGCGGGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCATGC AATCGCTAGA ATTGATATTA CTGCTAGTGT TTTCACTCAG CAGCAGCCTT 
0061 GTTCAGGGCC AAAATCCGGA TCCATTTGCC CAGCTTGCTT GCACGAAGTT CAAGCAGATT 
0121 GTCTTCGAGG AGCGCGTGGN CATCAGCTTC TTTTTCACCG ATGCACCCAT TACCTACGAG 
0181 ACAGTGGATT CCTGCCATGG ATCCAGACCC CTGATTGTGG ACGGCACGCC GGCGGAACCC 
0241 AAGGAATTTC CATTTGCCGC TCGCCTCGGC CATCGGAAAA CTAACAATGA AATAAAATGG 
0301 TTCTGTGGCG GCACCTTGAT ANAGCAATCG CCTGGTGCTC ACAGCGGCTC ACTGCTTTTT 
0361 TTCCGAACAC GGTGAGGTCA ACGTTGTGCG CTTGGGTGAA CTGGAGTTCG ATANCGACAC 
0421 GGATGACGCG GAACCCGAGG ACTTTGGCGT GCTCGCTCTG AAGGCACATC CTGGCTTCGA 
0481 GAACCCGCAA CTCTACAATG A 
 in silico PCR Fragment
0001 ATGGCCATGC AATCGCTAGA ATTGATATTA CTGCTAGTGT TTTCACTCAG CAGCAGCCTT 
0061 GTTCAGGGCC AAAATCCGGA TCCATTTGCC CAGCTTGCTT GCACGAAGTT CAAGCAGATT 
0121 GTCTTCGAAG AGCGCGTGGC CATTAGCTTC TTTTTCACCG ATGCACCCAT TACCTACGAG 
0181 ACAGTGGATT CCTGCCATGG ATCCAGACCC CTGATTGTGG ACGGCACGCC GGCGGAACCC 
0241 AAGGAATTTC CATTTGCCGC TCGCCTCGGC CATCGGAAAA CTAACAATGA AATAAAATGG 
0301 TTCTGTGGCG GCACCTTGAT A-AGCAATCG CCTGGTGCTC ACAGCGGCTC ACTGCTTTTT 
0361 TTCCGAACAC GGTGAGGTCA ACGTTGTGCG CTTGGGTGAA CTGGAGTTCG ATACCGACAC 
0421 GGATGACGCG GAACCCGAGG ACTTTGGCGT GCTCGCTCTG AAGGCACATC CTGGCTTCGA 
0481 GAACCCGCAA CTCTACAATG A 
 Assemble Data

11841R-4.IR_full       1   ATGGCCATGCAATCGCTAGAATTGATATTACTGCTAGTGTTTTCACTCAGCAGCAGCCTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     1   ATGGCCATGCAATCGCTAGAATTGATATTACTGCTAGTGTTTTCACTCAGCAGCAGCCTT 60


11841R-4.IR_full       61  GTTCAGGGCCAAAATCCGGATCCATTTGCCCAGCTTGCTTGCACGAAGTTCAAGCAGATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     61  GTTCAGGGCCAAAATCCGGATCCATTTGCCCAGCTTGCTTGCACGAAGTTCAAGCAGATT 120


11841R-4.IR_full       121 GTCTTCGAGGAGCGCGTGGNCATCAGCTTCTTTTTCACCGATGCACCCATTACCTACGAG 180
                           |||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||
11841R-4.in silico     121 GTCTTCGAAGAGCGCGTGGCCATTAGCTTCTTTTTCACCGATGCACCCATTACCTACGAG 180


11841R-4.IR_full       181 ACAGTGGATTCCTGCCATGGATCCAGACCCCTGATTGTGGACGGCACGCCGGCGGAACCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     181 ACAGTGGATTCCTGCCATGGATCCAGACCCCTGATTGTGGACGGCACGCCGGCGGAACCC 240


11841R-4.IR_full       241 AAGGAATTTCCATTTGCCGCTCGCCTCGGCCATCGGAAAACTAACAATGAAATAAAATGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     241 AAGGAATTTCCATTTGCCGCTCGCCTCGGCCATCGGAAAACTAACAATGAAATAAAATGG 300


11841R-4.IR_full       301 TTCTGTGGCGGCACCTTGATANAGCAATCGCCTGGTGCTCACAGCGGCTCACTGCTTTTT 360
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     301 TTCTGTGGCGGCACCTTGATA-AGCAATCGCCTGGTGCTCACAGCGGCTCACTGCTTTTT 360


11841R-4.IR_full       361 TTCCGAACACGGTGAGGTCAACGTTGTGCGCTTGGGTGAACTGGAGTTCGATANCGACAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
11841R-4.in silico     361 TTCCGAACACGGTGAGGTCAACGTTGTGCGCTTGGGTGAACTGGAGTTCGATACCGACAC 420


11841R-4.IR_full       421 GGATGACGCGGAACCCGAGGACTTTGGCGTGCTCGCTCTGAAGGCACATCCTGGCTTCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11841R-4.in silico     421 GGATGACGCGGAACCCGAGGACTTTGGCGTGCTCGCTCTGAAGGCACATCCTGGCTTCGA 480


11841R-4.IR_full       481 GAACCCGCAACTCTACAATGA 501
                           |||||||||||||||||||||
11841R-4.in silico     481 GAACCCGCAACTCTACAATGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143404.1  CG11841-RA (CG11841), mRNA 
0.2   NM_136857.2  CG12443-RA (ths), mRNA 
0   NM_133068.2  CG6361-RA (CG6361), mRNA 
0   NM_169869.1  CG31219-RA (CG31219), mRNA 
0   NM_141184.2  CG14642-RA, transcript variant A (CG14642), mRNA 
0   NM_164322.1  CG14642-RB, transcript variant B (CG14642), mRNA 
0   NM_139629.1  CG11582-RA (CG11582), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_169335.2  CG3985-RC, transcript variant C (Syn), mRNA 
0   NM_169333.2  CG3985-RE, transcript variant E (Syn), mRNA 
0   NM_169334.2  CG3985-RD, transcript variant D (Syn), mRNA 
0   NM_176451.2  CG3985-RF, transcript variant F (Syn), mRNA 
0   NM_169332.2  CG3985-RA, transcript variant A (Syn), mRNA 
0   NM_143405.1  CG11842-RA (CG11842), mRNA 
0   NM_132275.1  CG1994-RA (l(1)G0020), mRNA 
0   NM_139401.1  CG13933-RA (CG13933), mRNA 
0   NM_134979.2  CG15429-RA (CG15429), mRNA 
0   NM_143260.2  CG14253-RB, transcript variant B (CG14253), mRNA 
0   NM_136451.1  CG2137-RA (CG2137), mRNA 
0   NM_170301.1  CG14253-RC, transcript variant C (CG14253), mRNA 
0   NM_170300.1  CG14253-RA, transcript variant A (CG14253), mRNA 
0   NM_170302.1  CG14253-RD, transcript variant D (CG14253), mRNA 
0   NM_170303.1  CG14253-RE, transcript variant E (CG14253), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_143372.1  CG9995-RA (htt), mRNA 
0   NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   NM_132209.1  CG2256-RB (CG2256), mRNA 
0   10  NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.