National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11804R-1 
 Symbol ced-6  Full Name ced-6 
 CG No CG11804  Old CG No CG11804 
 Synonyms CG11804, drced-6, ced-6 
 Accession No (Link to NCBI) NM_165675.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nakano R, Iwamura M, Obikawa A, Togane Y, Hara Y, Fukuhara T, Tomaru M, Takano-Shimizu T, Tsujimura H.
Cortex glia clear dead young neurons via Drpr/dCed-6/Shark and Crk/Mbc/dCed-12 signaling pathways in the developing Drosophila optic lobe.
Dev. Biol. (2019) [ PubMed ID = 31063730 ] [ RRC reference ]

Awasaki T, Tatsumi R, Takahashi K, Arai K, Nakanishi Y, Ueda R, Ito K.
Essential role of the apoptotic cell engulfment genes draper and ced-6 in programmed axon pruning during Drosophila metamorphosis.
Neuron (2006) 50(6) 855-67 [ PubMed ID = 16772168 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCTTATCAGCCAGCCAAC 
 Primer Seq. 3'
aatctagaggtaccCCTTCTCGTCCGCACAATACG 
 Predicted Fragment Size
511 
 IR fragment full Seq
0001 ATGCCTTATC AGCCAGCCAA CAGCGGCGGG ACGTCTGGTG GCAGCAAGGC GGCAGCCAAG 
0061 ATGGCCCAGC TAAAGTTCTG GAACAAGCAG AACAGCAGCA AGCAGCAGCA GCAGGACAAG 
0121 GACAAGGACG CCGCCGACGG GGGCAACAAC ACCAGTGGCG GCGGCACTGG TCTCAGCAAC 
0181 AGCAACGGGG ATGCCAAAAG CGAGGCCAAG AACGGCAAGC GCAACTGGCT GCACACGCCG 
0241 GAGCAGCTCA TCAGCGGACA CGCGGTCTAT CTAGTCAAGT TCTTTGGTAA CCTGAGCGTG 
0301 GATCAGCCCA AAGGGATTGA GGTGGTCAAG GAGGCCATTC GGAAGCTGCA GTTTGCCCAG 
0361 CAGATGAAGA AGGCGGAAAC GGGCACCCAG GAGAAGTTCA AGAAGCTTGA GATCACCATT 
0421 AGCATCAAGG GCGTGGCAAT CCAGGAGCCG CGCACCCACA AGATCCTCCA CCAGTTTCCG 
0481 CTGTACAACA TTTCGTATTG TGCGGACGAG AAGG 
 in silico PCR Fragment
0001 ATGCCTTATC AGCCAGCCAA CAGCGGCGGG ACGTCTGGTG GCAGCAAGGC GGCAGCCAAG 
0061 ATGGCCCAGC TAAAGTTCTG GAACAAGCAG AACAGCAGCA AGCAGCAGCA GCAGGACAAG 
0121 GACAAGGACG CCGCCGACGG GGGCAACAAC ACCAGTGGCG GCGGCACTGG ---CAGCAAC 
0181 AGCAACGGGG ATGCCAAAAG CGAGGCCAAG AACGGCAAGC GCAACTGGCT GCACACGCCG 
0241 GAGCAGCTCA TCAGCGGACA CGCGGTCTAT CTAGTCAAGT TCTTTGGTAA CCTGAGCGTG 
0301 GATCAGCCCA AAGGGATTGA GGTGGTCAAG GAGGCCATTC GGAAGCTGCA GTTTGCCCAG 
0361 CAGATGAAGA AGGCGGAAAC GGGCACCCAG GAGAAGTTCA AGAAGCTTGA GATCACCATT 
0421 AGCATCAAGG GCGTGGCAAT CCAGGAGCCG CGCACCCACA AGATCCTCCA CCAGTTTCCG 
0481 CTGTACAACA TTTCGTATTG TGCGGACGAG AAGG 
 Assemble Data

11804R-1.IR_full       1   ATGCCTTATCAGCCAGCCAACAGCGGCGGGACGTCTGGTGGCAGCAAGGCGGCAGCCAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     1   ATGCCTTATCAGCCAGCCAACAGCGGCGGGACGTCTGGTGGCAGCAAGGCGGCAGCCAAG 60


11804R-1.IR_full       61  ATGGCCCAGCTAAAGTTCTGGAACAAGCAGAACAGCAGCAAGCAGCAGCAGCAGGACAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     61  ATGGCCCAGCTAAAGTTCTGGAACAAGCAGAACAGCAGCAAGCAGCAGCAGCAGGACAAG 120


11804R-1.IR_full       121 GACAAGGACGCCGCCGACGGGGGCAACAACACCAGTGGCGGCGGCACTGGTCTCAGCAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||
11804R-1.in silico     121 GACAAGGACGCCGCCGACGGGGGCAACAACACCAGTGGCGGCGGCACTGG---CAGCAAC 180


11804R-1.IR_full       181 AGCAACGGGGATGCCAAAAGCGAGGCCAAGAACGGCAAGCGCAACTGGCTGCACACGCCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     181 AGCAACGGGGATGCCAAAAGCGAGGCCAAGAACGGCAAGCGCAACTGGCTGCACACGCCG 240


11804R-1.IR_full       241 GAGCAGCTCATCAGCGGACACGCGGTCTATCTAGTCAAGTTCTTTGGTAACCTGAGCGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     241 GAGCAGCTCATCAGCGGACACGCGGTCTATCTAGTCAAGTTCTTTGGTAACCTGAGCGTG 300


11804R-1.IR_full       301 GATCAGCCCAAAGGGATTGAGGTGGTCAAGGAGGCCATTCGGAAGCTGCAGTTTGCCCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     301 GATCAGCCCAAAGGGATTGAGGTGGTCAAGGAGGCCATTCGGAAGCTGCAGTTTGCCCAG 360


11804R-1.IR_full       361 CAGATGAAGAAGGCGGAAACGGGCACCCAGGAGAAGTTCAAGAAGCTTGAGATCACCATT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     361 CAGATGAAGAAGGCGGAAACGGGCACCCAGGAGAAGTTCAAGAAGCTTGAGATCACCATT 420


11804R-1.IR_full       421 AGCATCAAGGGCGTGGCAATCCAGGAGCCGCGCACCCACAAGATCCTCCACCAGTTTCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11804R-1.in silico     421 AGCATCAAGGGCGTGGCAATCCAGGAGCCGCGCACCCACAAGATCCTCCACCAGTTTCCG 480


11804R-1.IR_full       481 CTGTACAACATTTCGTATTGTGCGGACGAGAAGG 514
                           ||||||||||||||||||||||||||||||||||
11804R-1.in silico     481 CTGTACAACATTTCGTATTGTGCGGACGAGAAGG 514

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   493  13  NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
100   493  13  NM_136644.2  CG11804-RC, transcript variant C (ced-6), mRNA 
100   493  13  NM_165675.1  CG11804-RA, transcript variant A (ced-6), mRNA 
0.4   NM_169505.1  CG8795-RA, transcript variant A (CG8795), mRNA 
0.4   NM_001014618.1  CG8795-RC, transcript variant C (CG8795), mRNA 
0.4   NM_169506.1  CG8795-RB, transcript variant B (CG8795), mRNA 
0.2   18  NM_143302.1  CG14264-RA (CG14264), mRNA 
0.2   11  NM_137921.1  CG30188-RA (CG30188), mRNA 
0.2   41  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
0.2   39  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
0.2   40  NM_132437.1  CG15207-RA (CG15207), mRNA 
0.2   NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0.2   NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0.2   NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0.2   NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0.2   NM_141620.2  CG8454-RA (Vps16A), mRNA 
0   23  NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_167262.1  CG11160-RB, transcript variant B (CG11160), mRNA 
0   NM_132447.1  CG11160-RA, transcript variant A (CG11160), mRNA 
0   NM_165153.1  CG31817-RA (CG31817), mRNA 
0   31  NM_001042891.1  CG31761-RE, transcript variant E (bru-2), mRNA 
0   30  NM_135715.2  CG31761-RA, transcript variant A (bru-2), mRNA 
0   30  NM_165007.1  CG31761-RC, transcript variant C (bru-2), mRNA 
0   30  NM_176025.1  CG31761-RD, transcript variant D (bru-2), mRNA 
0   13  NM_169223.2  CG31369-RA (PQBP-1), mRNA 
0   29  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   29  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   21  NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   21  NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   10  NM_168811.1  CG32209-RB (CG32209), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.