National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11785R-2 
 Symbol bai  Full Name baiser 
 CG No CG11785  Old CG No CG11785 
 Synonyms 150547_at, CG11785, BcDNA:RE52411, bai 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCCAGAAGTGCCTCAAGGA 
 Primer Seq. 3'
aatctagaggtaccGGTACAGAACTTGCCACGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11785R-2.IR full       1   CACCCAGAAGTGCCTCAAGGAAGACATCCAGGCGAACCAACTGGTTATGGGCGAGTTCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     1   CACCCAGAAGTGCCTCAAGGAAGACATCCAGGCGAACCAACTGGTTATGGGCGAGTTCGA 60


11785R-2.IR full       61  AGTTTCCGACGTACCCGGCCAGATCATCGACTACATTGCACGCGACACCAAGGGACACAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     61  AGTTTCCGACGTACCCGGCCAGATCATCGACTACATTGCACGCGACACCAAGGGACACAT 120


11785R-2.IR full       121 CCTGTCGCAGAAGGAGCACATCACTAAGGGCAAGTTCAGCTTCATGTCCGAGGTGTACGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     121 CCTGTCGCAGAAGGAGCACATCACTAAGGGCAAGTTCAGCTTCATGTCCGAGGTGTACGA 180


11785R-2.IR full       181 TACGTACGAAATCTGCTTCATATCCAAAGTTCCTGCACATCAACGCGGCGTTATACAGGA 240
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     181 TACGTACGAAATCTGCTTTATATCCAAAGTTCCTGCACATCAACGCGGCGTTATACAGGA 240


11785R-2.IR full       241 AGTATCGCTCTTGACCAAAAAGGGAGTGGAGACCAAGAGCTACGAAGGCATTGGCGAAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     241 AGTATCGCTCTTGACCAAAAAGGGAGTGGAGACCAAGAGCTACGAAGGCATTGGCGAAGC 300


11785R-2.IR full       301 ATCCAAACTGAAGCCCCTTGAAGTTGATCTTAAGCGTTTGGAGGATCTCTCCGACTCCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     301 ATCCAAACTGAAGCCCCTTGAAGTTGATCTTAAGCGTTTGGAGGATCTCTCCGACTCCAT 360


11785R-2.IR full       361 TGTGCGTGATTTCGTTCTCATGCGCAAGCGGGAGGAGGAAATGCGCGATACCAATGAGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11785R-2.in silico     361 TGTGCGTGATTTCGTTCTCATGCGCAAGCGGGAGGAGGAAATGCGCGATACCAATGAGAA 420


11785R-2.IR full       421 AACCAACAGCCGCGTGCTGTTCTTCAGCATCTTCAGCATGTGCTNCNTGCTCGGCTTGGC 480
                           |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
11785R-2.in silico     421 AACCAACAGCCGCGTGCTGTTCTTCAGCATCTTCAGCATGTGCTGCCTGCTCGGCTTGGC 480


11785R-2.IR full       481 GACGTGGCAAGTTCTGTACC 500
                           ||||||||||||||||||||
11785R-2.in silico     481 GACGTGGCAAGTTCTGTACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.