National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11783R-2 
 Symbol Hr96  Full Name Hormone receptor-like in 96 
 CG No CG11783  Old CG No CG11783 
 Synonyms DHR96, NR1J1, Dhr96, CG11783, Hr96 
 Accession No (Link to NCBI) NM_079769.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Giraudo M, Unnithan GC, Le Goff G, Feyereisen R.
Regulation of cytochrome P450 expression in Drosophila: Genomic insights.
Pestic Biochem Physiol (2010) 97(2) 115-122 [ PubMed ID = 20582327 ] [ RRC reference ]

Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGAGAGCTGCAAGGCGTTC 
 Primer Seq. 3'
aatctagaggtaccAACCGGTTGATGGCCTGCGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCGAGAGCT GCAAGGCGTT CTTCCGACGG AACGCGCTGG CCAAGAAGCA GTTCACCTGC 
0061 CCCTTCAACC AAAACTGCGA CATCACTGTG GTCACTCGAC GCTTCTGCCA GAAATGCCGC 
0121 CTGCGCAAGT GCCTGGAGAT CGGGATGAAG AGTGAAAACA TTATGTCCGA GGAGGACAAG 
0181 CTGATCAAGC GGCNCAAGAT CGAGACCAAC CGGGCCAAGC GACGCCTCAT GGAGAACGGC 
0241 ACAGATGCGT GCGACGCCGA TGGCGGCGAG NGAAAGGGAT CACAAAGCGC CGGCGGATAG 
0301 CAGCAGCAGC AACCTTGACC ACTACTCGGG GTCACAGGAC TCGCAGAGCT GCGGCTCGGC 
0361 GGACAGCGGN GGCCAATGGG TGCTCCGGCA GACAGGCCAG TTCGCCGGGC ACACAAGTCA 
0421 ATCCGCTTCA GATGACGGCC GAGAAGATAG TCGACCAGAT CGTATCCGAC CCGGATCGAG 
0481 CCTCGCAGGC CATCAACCGG TT 
 in silico PCR Fragment
0001 TGCGAGAGCT GCAAGGCGTT CTTCCGACGG AACGCGCTGG CCAAGAAGCA GTTCACCTGC 
0061 CCCTTCAACC AAAACTGCGA CATCACTGTG GTCACTCGAC GCTTCTGCCA GAAATGCCGC 
0121 CTGCGCAAGT GCCTGGATAT CGGGATGAAG AGTGAAAACA TTATGTCCGA GGAGGACAAG 
0181 CTGATCAAGC GGCGCAAGAT CGAGACCAAC CGGGCCAAGC GACGCCTCAT GGAGAACGGC 
0241 ACGGATGCGT GCGACGCCGA TGGCGGCGAG -GAAAGGGAT CACAAAGCGC CGGCGGATAG 
0301 CAGCAGCAGC AACCTTGACC ACTACTCGGG GTCACAGGAC TCGCAGAGCT GCGGCTCGGC 
0361 GGACAGCGG- GGCCAATGGG TGCTCCGGCA GACAGGCCAG TTCGCCGGGC ACACAGGTCA 
0421 ATCCGCTTCA GATGACGGCC GAGAAGATAG TCGACCAGAT CGTATCCGAC CCGGATCGAG 
0481 CCTCGCAGGC CATCAACCGG TT 
 Assemble Data

11783R-2.IR_full       1   TGCGAGAGCTGCAAGGCGTTCTTCCGACGGAACGCGCTGGCCAAGAAGCAGTTCACCTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     1   TGCGAGAGCTGCAAGGCGTTCTTCCGACGGAACGCGCTGGCCAAGAAGCAGTTCACCTGC 60


11783R-2.IR_full       61  CCCTTCAACCAAAACTGCGACATCACTGTGGTCACTCGACGCTTCTGCCAGAAATGCCGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     61  CCCTTCAACCAAAACTGCGACATCACTGTGGTCACTCGACGCTTCTGCCAGAAATGCCGC 120


11783R-2.IR_full       121 CTGCGCAAGTGCCTGGAGATCGGGATGAAGAGTGAAAACATTATGTCCGAGGAGGACAAG 180
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     121 CTGCGCAAGTGCCTGGATATCGGGATGAAGAGTGAAAACATTATGTCCGAGGAGGACAAG 180


11783R-2.IR_full       181 CTGATCAAGCGGCNCAAGATCGAGACCAACCGGGCCAAGCGACGCCTCATGGAGAACGGC 240
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     181 CTGATCAAGCGGCGCAAGATCGAGACCAACCGGGCCAAGCGACGCCTCATGGAGAACGGC 240


11783R-2.IR_full       241 ACAGATGCGTGCGACGCCGATGGCGGCGAGNGAAAGGGATCACAAAGCGCCGGCGGATAG 300
                           || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
11783R-2.in silico     241 ACGGATGCGTGCGACGCCGATGGCGGCGAG-GAAAGGGATCACAAAGCGCCGGCGGATAG 300


11783R-2.IR_full       301 CAGCAGCAGCAACCTTGACCACTACTCGGGGTCACAGGACTCGCAGAGCTGCGGCTCGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     301 CAGCAGCAGCAACCTTGACCACTACTCGGGGTCACAGGACTCGCAGAGCTGCGGCTCGGC 360


11783R-2.IR_full       361 GGACAGCGGNGGCCAATGGGTGCTCCGGCAGACAGGCCAGTTCGCCGGGCACACAAGTCA 420
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||
11783R-2.in silico     361 GGACAGCGG-GGCCAATGGGTGCTCCGGCAGACAGGCCAGTTCGCCGGGCACACAGGTCA 420


11783R-2.IR_full       421 ATCCGCTTCAGATGACGGCCGAGAAGATAGTCGACCAGATCGTATCCGACCCGGATCGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11783R-2.in silico     421 ATCCGCTTCAGATGACGGCCGAGAAGATAGTCGACCAGATCGTATCCGACCCGGATCGAG 480


11783R-2.IR_full       481 CCTCGCAGGCCATCAACCGGTT 502
                           ||||||||||||||||||||||
11783R-2.in silico     481 CCTCGCAGGCCATCAACCGGTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079769.2  CG11783-RA (Hr96), mRNA 
0.41   NM_132896.1  CG9981-RA (CG9981), mRNA 
0.41   NM_168938.1  CG7383-RB, transcript variant B (eg), mRNA 
0.41   NM_079482.3  CG7383-RA, transcript variant A (eg), mRNA 
0   30  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   30  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_135140.2  CG12393-RA, transcript variant A (CG12393), mRNA 
0   NM_164678.1  CG12393-RB, transcript variant B (CG12393), mRNA 
0   NM_136496.2  CG14763-RA (CG14763), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
0   NM_176174.1  CG12864-RB, transcript variant B (Su(var)2-HP2), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_057324.3  CG5109-RA (Pcl), mRNA 
0   10  NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_078827.1  CG4977-RA (kek2), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_132816.2  CG7872-RA (CG7872), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   10  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   10  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_167435.2  CG6146-RB, transcript variant B (Top1), mRNA 
0   NM_165519.1  CG11166-RC, transcript variant C (CG11166), mRNA 
0   NM_206048.1  CG11166-RG, transcript variant G (CG11166), mRNA 
0   NM_165518.1  CG11166-RA, transcript variant A (CG11166), mRNA 
0   NM_206049.1  CG11166-RF, transcript variant F (CG11166), mRNA 
0   NM_165520.1  CG11166-RE, transcript variant E (CG11166), mRNA 
0   NM_136429.2  CG11166-RD, transcript variant D (CG11166), mRNA 
0   NM_135024.1  CG11926-RA (CG11926), mRNA 
0   NM_153771.2  CG8920-RC, transcript variant C (CG8920), mRNA 
0   NM_137631.5  CG8920-RB, transcript variant B (CG8920), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.