National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11783R-1 
 Symbol Hr96  Full Name Hormone receptor-like in 96 
 CG No CG11783  Old CG No CG11783 
 Synonyms DHR96, NR1J1, Dhr96, CG11783, Hr96 
 Accession No (Link to NCBI) NM_079769.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCGAGAGCTGCAAGGCGTTCTTCCGACGGAACGCGCTGGCCAAGAAGCAGTTCACCTGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCCTTCAACCAAAACTGCGACATCACTGTGGTCACTCGACGCTTCTGCCAGAAATGCCGC 120

                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     121 CTGCGCAAGTGCCTGGATATCGGGATGAAGAGTGAAAACATTATGTCCGAGGAGGACAAG 180

                           ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGATCAAGCGGCGCAAGATCGAGACCAACCGGGCCAAGCGACGCCTCATGGAGAACGGC 240

                           || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     241 ACGGATGCGTGCGACGCCGATGGCGGCGAG-GAAAGGGATCACAAAGCGCCGGCGGATAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCAGCAGCAACCTTGACCACTACTCGGGGTCACAGGACTCGCAGAGCTGCGGCTCGGC 360

                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| silico     361 GGACAGCGG-GGCCAATGGGTGCTCCGGCAGACAGGCCAGTTCGCCGGGCACACAGGTCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCCGCTTCAGATGACGGCCGAGAAGATAGTCGACCAGATCGTATCCGACCCGGATCGAG 480

11783R-1.IR_full       481 CCTCGCAGGCCATCAACCGGTT 502
                           |||||||||||||||||||||| silico     481 CCTCGCAGGCCATCAACCGGTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079769.2  CG11783-RA (Hr96), mRNA 
0.41   NM_132896.1  CG9981-RA (CG9981), mRNA 
0.41   NM_168938.1  CG7383-RB, transcript variant B (eg), mRNA 
0.41   NM_079482.3  CG7383-RA, transcript variant A (eg), mRNA 
0   30  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   30  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_135140.2  CG12393-RA, transcript variant A (CG12393), mRNA 
0   NM_164678.1  CG12393-RB, transcript variant B (CG12393), mRNA 
0   NM_136496.2  CG14763-RA (CG14763), mRNA 
0   NM_137128.2  CG12864-RA, transcript variant A (Su(var)2-HP2), mRNA 
0   NM_176174.1  CG12864-RB, transcript variant B (Su(var)2-HP2), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_057324.3  CG5109-RA (Pcl), mRNA 
0   10  NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_078827.1  CG4977-RA (kek2), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_132816.2  CG7872-RA (CG7872), mRNA 
0   NM_167189.2  CG32705-RA (CG32705), mRNA 
0   10  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   10  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_167435.2  CG6146-RB, transcript variant B (Top1), mRNA 
0   NM_165519.1  CG11166-RC, transcript variant C (CG11166), mRNA 
0   NM_206048.1  CG11166-RG, transcript variant G (CG11166), mRNA 
0   NM_165518.1  CG11166-RA, transcript variant A (CG11166), mRNA 
0   NM_206049.1  CG11166-RF, transcript variant F (CG11166), mRNA 
0   NM_165520.1  CG11166-RE, transcript variant E (CG11166), mRNA 
0   NM_136429.2  CG11166-RD, transcript variant D (CG11166), mRNA 
0   NM_135024.1  CG11926-RA (CG11926), mRNA 
0   NM_153771.2  CG8920-RC, transcript variant C (CG8920), mRNA 
0   NM_137631.5  CG8920-RB, transcript variant B (CG8920), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.