National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11780R-1 
 Symbol beta4GalT7  Full Name beta-4-galactosyltransferase 7 
 CG No CG11780  Old CG No CG11780 
 Synonyms CG11780, dbeta4GalTI, Dbeta4GalT7, beta4GalT7, dbeta4GalT7 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees Lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ueyama M, Takemae H, Ohmae Y, Yoshida H, Toyoda H, Ueda R, Nishihara S.
Functional analysis of proteoglycan galactosyltransferase II RNA interference mutant flies.
J. Biol. Chem. (2008) 283(10) 6076-84 [ PubMed ID = 18165227 ] [ RRC reference ]

Goda E, Kamiyama S, Uno T, Yoshida H, Ueyama M, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S.
Identification and characterization of a novel Drosophila 3'-phosphoadenosine 5'-phosphosulfate transporter.
J. Biol. Chem. (2006) 281(39) 28508-17 [ PubMed ID = 16873373 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCACCATAAACTGGGTCTTCG 
 Primer Seq. 3'
aatctagaggtaccTGGTCCCAAGCTGCTGGGATA 
 Predicted Fragment Size
482 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11780R-1.IR full       1   ---CCATAAACTGGGTCTTCGTCTGCGGCCTGTCCTTTTGCCTNGGCGGGATTGCGGTGC 60
                              |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
11780R-1.in silico     1   CCACCATAAACTGGGTCTTCGTCTGCGGCCTGTCCTTTTGCCTGGGCGGGATTGCGGTGC 60


11780R-1.IR full       61  TCAGTCTCATGCCATTGGGATCAGACTGCGTGTGCCCGCTGTCCAATCCGCTGGCCAAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11780R-1.in silico     61  TCAGTCTCATGCCATTGGGATCAGACTGCGTGTGCCCGCTGTCCAATCCGCTGGCCAAGC 120


11780R-1.IR full       121 TTGCCGGTGGCGGAGAAGGTGTATCCGTGATTAAGAAAGAGCCAGCCGATGAGAAGCAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11780R-1.in silico     121 TTGCCGGTGGCGGAGAAGGTGTATCCGTGATTAAGAAAGAGCCAGCCGATGAGAAGCAGC 180


11780R-1.IR full       181 CACAGCCACATGACCACGGTGCGTCCGTACACAAGATGGCACTGCTGGTGCCGTTTCGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11780R-1.in silico     181 CACAGCCACATGACCACGGTGCGTCCGTACACAAGATGGCACTGCTGGTGCCGTTTCGAG 240


11780R-1.IR full       241 ACCGATTTGAGGAACTCCTCCAGTTCGTNCCNCANATGACCGCCTTTTTGAAGCGGCAGG 300
                           |||||||||||||||||||||||||||| || || |||||||||||||||||||||||||
11780R-1.in silico     241 ACCGATTTGAGGAACTCCTCCAGTTCGTCCCCCACATGACCGCCTTTTTGAAGCGGCAGG 300


11780R-1.IR full       301 GCGTGGCGCACCACATCTTTGTGCTGAACCAGGTGGACAGATTCCGCTTCAATCGCGCCT 360
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
11780R-1.in silico     301 GCGTGGCGCACCACATCTTTGTGCTGAACCAGGTGGACAGGTTCCGCTTCAATCGCGCCT 360


11780R-1.IR full       361 CTCTCATCAACGTGGGTTTCCAGTTTGCCAGCGATGTGTACGATTACATTGCCATGCACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11780R-1.in silico     361 CTCTCATCAACGTGGGTTTCCAGTTTGCCAGCGATGTGTACGATTACATTGCCATGCACG 420


11780R-1.IR full       421 ACGTAGACTTGCTGCCCTTGAATGACAATCTGCTCTATGAGTATCCCAGCAGCTTGGGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11780R-1.in silico     421 ACGTAGACTTGCTGCCCTTGAATGACAATCTGCTCTATGAGTATCCCAGCAGCTTGGGAC 480


11780R-1.IR full       481 CA 482
                           ||
11780R-1.in silico     481 CA 482

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  464  NM_143062.2  beta-4-galactosyltransferase 7 CG11780-RA (beta4GalT7), mRNA 
NM_143154.3  CG5053-RA (CG5053), mRNA 
NM_132687.1  CG9941-RA (CG9941), mRNA 
NM_137510.2  CG30122-RB (CG30122), mRNA 
NM_001042822.1  CG34120-RC, transcript variant C (CG34120), mRNA 
NM_135529.2  no mitochondrial derivative CG5395-RA (nmd), mRNA 
NM_141069.2  CG7611-RA, transcript variant A (CG7611), mRNA 
NM_168915.1  CG7611-RD, transcript variant D (CG7611), mRNA 
NM_168914.1  CG7611-RC, transcript variant C (CG7611), mRNA 
NM_168919.1  CG7611-RH, transcript variant H (CG7611), mRNA 
NM_168913.1  CG7611-RB, transcript variant B (CG7611), mRNA 
NM_168918.1  CG7611-RG, transcript variant G (CG7611), mRNA 
NM_168917.1  CG7611-RF, transcript variant F (CG7611), mRNA 
NM_168916.1  CG7611-RE, transcript variant E (CG7611), mRNA 
NM_176755.1  RhoGAP16F CG7122-RB, transcript variant B (RhoGAP16F), mRNA 
NM_133039.3  RhoGAP16F CG7122-RA, transcript variant A (RhoGAP16F), mRNA 
NM_165750.2  gemini CG30011-RA, transcript variant A (gem), mRNA 
NM_136712.2  gemini CG30011-RC, transcript variant C (gem), mRNA 
NM_079548.4  doublesex CG11094-RC, transcript variant C (dsx), mRNA 
NM_169203.1  doublesex CG11094-RB, transcript variant B (dsx), mRNA 
NM_169202.1  doublesex CG11094-RA, transcript variant A (dsx), mRNA 
NM_142362.2  sds22 CG5851-RA (sds22), mRNA 
NM_001032250.1  CG30084-RE, transcript variant E (CG30084), mRNA 
NM_001043086.1  CG30084-RG, transcript variant G (CG30084), mRNA 
NM_140347.1  CG11008-RA (CG11008), mRNA 
NM_206555.1  Myosin 95E CG5501-RD, transcript variant D (Myo95E), mRNA 
NM_206556.1  Myosin 95E CG5501-RB, transcript variant B (Myo95E), mRNA 
NM_001032037.1  Myosin 95E CG5501-RE, transcript variant E (Myo95E), mRNA 
NM_001032035.1  Myosin 95E CG5501-RG, transcript variant G (Myo95E), mRNA 
NM_001032036.1  Myosin 95E CG5501-RF, transcript variant F (Myo95E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.