National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11642R-3 
 Symbol TRAM  Full Name TRAM 
 CG No CG11642  Old CG No CG11642 
 Synonyms CG11642, CG18830, EG:BACR7A4.5, TRAM 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| silico     1   CATTAAACCGGGACTCGGTCGCAAGACCAGCAACAAGAACCCGCCTATCCTGAGCCACGA 60

                           ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     61  GTTTGTGATCCAGAACCACGCGGACATCATCTCCTGCGTAGCCATGGTCTTCGTGGTCGG 120

                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     121 CCTGATGAACGAGTCGACGGCGGCGTTCGCCAGCGCGTTCATATCCCTGCACCACAACGT 180

                           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     181 CAGCGGTGAGGACCCCAGCCGGGAGCAGCCATATGGCAAGCCATACACCTACATCGCCGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCAAGGATTACTGCGCGATATTCTTCTACACGCTGACCTGCATAATCATGCACGCGAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATCCAGGAGTTCGTGCTGGACAAGATCAGCAAAAAACTACACCTGTCCAAGTTCAAGCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCCCGCTTCAACGAGTCCGGCCAACTGGTGGCCTTCTACCTGCTCTCCTTCGTCTGGGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCCCACGTGCTGCTGAAGGAGGGCTACCTCGGACAGGTGGCCCAGCTGTGGGAGGGCTT 480

11642R-3.IR full       481 CCCCGACCATCCCATGANNN 500
                           ||||||||||||||||| silico     481 CCCCGACCATCCCATGAGCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.