National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11579R-2 
 Symbol arm  Full Name armadillo 
 CG No CG11579  Old CG No CG11579 
 Synonyms arm, Arm, Beta-cat, Beta-catenin, beta-cat, CG11579, t12687 ALR Dm, ARM, EG:86E4.6, l(1)G0410, l(1)G0192, l(1)G0234, l(1)arm, l(1)2Bv 
 Accession No (Link to NCBI) NM_057318.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Li X, Wang Y, Wang H, Liu T, Guo J, Yi W, Li Y.
Epithelia-derived wingless regulates dendrite directional growth of drosophila ddaE neuron through the Fz-Fmi-Dsh-Rac1 pathway.
Mol Brain (2016) 9(1) 46 [ PubMed ID = 27129721 ] [ RRC reference ]

Taniue K, Nishida A, Hamada F, Sugie A, Oda T, Ui-Tei K, Tabata T, Akiyama T.
Sunspot, a link between Wingless signaling and endoreplication in Drosophila.
Development (2010) 137(10) 1755-64 [ PubMed ID = 20430750 ] [ RRC reference ]

Zhang S, Chen C, Wu C, Yang Y, Li W, Xue L.
The canonical Wg signaling modulates Bsk-mediated cell death in Drosophila.
Cell Death Dis (2015) 6 e1713 [ PubMed ID = 25855961 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATCCGCCAAGGAGCAGACCC 
 Primer Seq. 3'
aatctagaggtaccCGAGGCCTCCTTCTTAGACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TATCCGCCAA GGAGCAGACC CTCATGTGGC AGCAGAATTC GTACTTGGGC GACTCCGGCA 
0061 TCCACTCGGG TGCCGTGACC CAGGTTCCAT CGCTGTCTGG CAAGGAGGAC GAGGAGATGG 
0121 AGGGAGATCC ACTTATGTTC GACCTGGACA CCGGTTTCCC GCAGAATTTC ACACAAGACC 
0181 AAGTGGACGA TATGAACCAG CAACTGAGCC AGACACGCTC CCAACGTGTA CGTGCTGCCA 
0241 TGTTTCCGGA AACCCTGGAG GAGGGCATTG AGATTCCCTC CACCCAGTTT GATCCCCAAC 
0301 AGCCGACGGC AGTGCAACGT CNTTTCGGAA CCGTCACAAA TGCTAAAGCA CGCGGTGGTC 
0361 AATCTGATCA ACTACCAGGA CGACGCTGAG CTGGCAACCA GGGCCATACC CGAGTTGATC 
0421 AAGCTGCTGA ACGATGAGGA TCAGGTGGTA GTTTCCCAGG CCGCCATGAT GGTCCACCAG 
0481 CTGTCTAAGA AGGAGGNCTC G 
 in silico PCR Fragment
0001 TATCCGCCAA GGAGCAGACC CTCATGTGGC AGCAGAATTC GTACTTGGGC GACTCCGGCA 
0061 TCCACTCGGG TGCCGTGACC CAGGTTCCAT CGCTGTCTGG CAAGGAGGAC GAGGAGATGG 
0121 AGGGAGATCC ACTTATGTTC GACCTGGACA CCGGTTTCCC GCAGAATTTC ACACAAGACC 
0181 AAGTGGACGA TATGAACCAG CAACTGAGCC AGACACGCTC CCAACGTGTA CGTGCTGCCA 
0241 TGTTTCCGGA AACCCTGGAG GAGGGCATTG AGATTCCCTC CACCCAGTTT GATCCCCAAC 
0301 AGCCGACGGC AGTGCAACGT C-TTTCGGAA CCGTCACAAA TGCTAAAGCA CGCGGTGGTC 
0361 AATCTGATCA ACTACCAGGA CGACGCTGAG CTGGCAACCA GGGCCATACC CGAGTTGATC 
0421 AAGCTGCTGA ACGATGAGGA TCAGGTGGTA GTTTCCCAGG CCGCCATGAT GGTCCACCAG 
0481 CTGTCTAAGA AGGAGGCCTC G 
 Assemble Data

11579R-2.IR_full       1   TATCCGCCAAGGAGCAGACCCTCATGTGGCAGCAGAATTCGTACTTGGGCGACTCCGGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     1   TATCCGCCAAGGAGCAGACCCTCATGTGGCAGCAGAATTCGTACTTGGGCGACTCCGGCA 60


11579R-2.IR_full       61  TCCACTCGGGTGCCGTGACCCAGGTTCCATCGCTGTCTGGCAAGGAGGACGAGGAGATGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     61  TCCACTCGGGTGCCGTGACCCAGGTTCCATCGCTGTCTGGCAAGGAGGACGAGGAGATGG 120


11579R-2.IR_full       121 AGGGAGATCCACTTATGTTCGACCTGGACACCGGTTTCCCGCAGAATTTCACACAAGACC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     121 AGGGAGATCCACTTATGTTCGACCTGGACACCGGTTTCCCGCAGAATTTCACACAAGACC 180


11579R-2.IR_full       181 AAGTGGACGATATGAACCAGCAACTGAGCCAGACACGCTCCCAACGTGTACGTGCTGCCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     181 AAGTGGACGATATGAACCAGCAACTGAGCCAGACACGCTCCCAACGTGTACGTGCTGCCA 240


11579R-2.IR_full       241 TGTTTCCGGAAACCCTGGAGGAGGGCATTGAGATTCCCTCCACCCAGTTTGATCCCCAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     241 TGTTTCCGGAAACCCTGGAGGAGGGCATTGAGATTCCCTCCACCCAGTTTGATCCCCAAC 300


11579R-2.IR_full       301 AGCCGACGGCAGTGCAACGTCNTTTCGGAACCGTCACAAATGCTAAAGCACGCGGTGGTC 360
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     301 AGCCGACGGCAGTGCAACGTC-TTTCGGAACCGTCACAAATGCTAAAGCACGCGGTGGTC 360


11579R-2.IR_full       361 AATCTGATCAACTACCAGGACGACGCTGAGCTGGCAACCAGGGCCATACCCGAGTTGATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     361 AATCTGATCAACTACCAGGACGACGCTGAGCTGGCAACCAGGGCCATACCCGAGTTGATC 420


11579R-2.IR_full       421 AAGCTGCTGAACGATGAGGATCAGGTGGTAGTTTCCCAGGCCGCCATGATGGTCCACCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11579R-2.in silico     421 AAGCTGCTGAACGATGAGGATCAGGTGGTAGTTTCCCAGGCCGCCATGATGGTCCACCAG 480


11579R-2.IR_full       481 CTGTCTAAGAAGGAGGNCTCG 501
                           |||||||||||||||| ||||
11579R-2.in silico     481 CTGTCTAAGAAGGAGGCCTCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057317.3  CG11579-RD, transcript variant D (arm), mRNA 
100   482  NM_057318.3  CG11579-RA, transcript variant A (arm), mRNA 
100   482  NM_166912.2  CG11579-RC, transcript variant C (arm), mRNA 
100   482  NM_134273.2  CG11579-RB, transcript variant B (arm), mRNA 
100   482  NM_206605.1  CG11579-RE, transcript variant E (arm), mRNA 
0.2   NM_132151.1  CG14427-RA (CG14427), mRNA 
0   NM_137607.3  CG8654-RA (CG8654), mRNA 
0   NM_139491.1  CG1241-RA (Atg2), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_167624.1  CG6335-RA, transcript variant A (Aats-his), mRNA 
0   NM_133077.1  CG6335-RB, transcript variant B (Aats-his), mRNA 
0   NM_143223.1  CG14238-RA (CG14238), mRNA 
0   NM_135320.2  CG7093-RA (CG7093), mRNA 
0   12  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   15  NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   15  NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   15  NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   15  NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_080034.2  CG32561-RA (xmas-1), mRNA 
0   NM_130681.1  CG14424-RA (CG14424), mRNA 
0   17  NM_130602.2  CG3480-RA (mip130), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_141810.1  CG6719-RA (CG6719), mRNA 
0   NM_176780.1  CG14616-RE, transcript variant E (l(1)G0196), mRNA 
0   NM_176779.1  CG14616-RA, transcript variant A (l(1)G0196), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.