National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11561R-1 
 Symbol smo  Full Name smoothened 
 CG No CG11561  Old CG No CG11561 
 Synonyms CG11561, Smo, dSmo, smo, SMO 
 Accession No (Link to NCBI) NM_078719.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Li Z, Guo Y, Han L, Zhang Y, Shi L, Huang X, Lin X.
Debra-mediated Ci degradation controls tissue homeostasis in Drosophila adult midgut.
Stem Cell Reports (2014) 2(2) 135-44 [ PubMed ID = 24527387 ] [ RRC reference ]

Yang X, Mao F, Lv X, Zhang Z, Fu L, Lu Y, Wu W, Zhou Z, Zhang L, Zhao Y.
Drosophila Vps36 regulates Smo trafficking in Hedgehog signaling.
J. Cell. Sci. (2013) 126(Pt 18) 4230-8 [ PubMed ID = 23843610 ] [ RRC reference ]

Han H, Pan C, Liu C, Lv X, Yang X, Xiong Y, Lu Y, Wu W, Han J, Zhou Z, Jiang H, Zhang L, Zhao Y.
Gut-neuron interaction via Hh signaling regulates intestinal progenitor cell differentiation in Drosophila.
Cell Discov (2015) 1 15006 [ PubMed ID = 27462407 ] [ RRC reference ]

Lai CM, Lin KY, Kao SH, Chen YN, Huang F, Hsu HJ.
Hedgehog signaling establishes precursors for germline stem cell niches by regulating cell adhesion.
J. Cell Biol. (2017) 216(5) 1439-1453 [ PubMed ID = 28363970 ] [ RRC reference ]

Zhang Z, Lv X, Jiang J, Zhang L, Zhao Y.
Dual roles of Hh signaling in the regulation of somatic stem cell self-renewal and germline stem cell maintenance in Drosophila testis.
Cell Res. (2013) 23(4) 573-6 [ PubMed ID = 23419515 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTACCGACTGTACGCCAAGAA 
 Primer Seq. 3'
aatctagaggtaccCTGTCGGAACCAAAGGACTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTACCGACTG TACGCCAAGA AGGGCAGGGA CGACAAACCC TGGTTTGATG GCCTAGACAG 
0061 CAGGCACATC CAGTGTGTCC GACGTGCCCG TTGCTACCCC ACCTCGAACG CAACCAACAC 
0121 CTGTTTCGGC TCAAAATTGG CCTATGAGCT GAGCAGCCTA GATCTCACCG ACTTCCACAC 
0181 CGAAAAGGAG CTGAACGATA AGCTGAACGA CTACTATGCC CTGAAGCACG TGCCCAAATG 
0241 TTGGGCAGCT ATACAGCCCT TTTTGTGCGC CGTCTTTAAG CCGAAGTGTG AAAAAATCAA 
0301 CGGCGAGGAC ATGGTCTACC TGCCATCTTA CGAGATGTGC CGAATTACCA TGGAACCCTG 
0361 TCGCATTTTG TACAACACGA CGTTTTTCCC AAAATTCCTT CGCTGCAACG AAACACTCTT 
0421 TCCGACGAAA TGCACAAACG GAGCACGAGG AATGAAATTC AACGGAACTG GCCAGTGTTT 
0481 AAGTCCTTTG GTTCCGACAG  
 in silico PCR Fragment
0001 TTACCGACTG TACGCCAAGA AGGGCAGGGA CGACAAACCC TGGTTTGATG GCCTAGACAG 
0061 CAGGCACATC CAGTGTGTCC GACGTGCCCG TTGCTACCCC ACCTCGAACG CAACCAACAC 
0121 CTGTTTCGGC TCAAAATTGC CCTATGAGCT GAGCAGCCTA GATCTCACCG ACTTCCACAC 
0181 CGAAAAGGAG CTGAACGATA AGCTGAACGA CTACTATGCC CTGAAGCACG TGCCCAAATG 
0241 TTGGGCAGCT ATACAGCCCT TTTTGTGCGC CGTCTTTAAG CCGAAGTGTG AAAAAATCAA 
0301 CGGCGAGGAC ATGGTCTACC TGCCATCTTA CGAGATGTGC CGAATTACCA TGGAACCCTG 
0361 TCGCATTTTG TACAACACGA CGTTTTTCCC AAAATTCCTT CGCTGCAACG AAACACTCTT 
0421 TCCGACGAAA TGCACAAACG GAGCACGAGG AATGAAATTC AACGGAACTG GCCAGTGTTT 
0481 AAGTCCTTTG GTTCCGACAG  
 Assemble Data

11561R-1.IR_full       1   TTACCGACTGTACGCCAAGAAGGGCAGGGACGACAAACCCTGGTTTGATGGCCTAGACAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     1   TTACCGACTGTACGCCAAGAAGGGCAGGGACGACAAACCCTGGTTTGATGGCCTAGACAG 60


11561R-1.IR_full       61  CAGGCACATCCAGTGTGTCCGACGTGCCCGTTGCTACCCCACCTCGAACGCAACCAACAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     61  CAGGCACATCCAGTGTGTCCGACGTGCCCGTTGCTACCCCACCTCGAACGCAACCAACAC 120


11561R-1.IR_full       121 CTGTTTCGGCTCAAAATTGGCCTATGAGCTGAGCAGCCTAGATCTCACCGACTTCCACAC 180
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     121 CTGTTTCGGCTCAAAATTGCCCTATGAGCTGAGCAGCCTAGATCTCACCGACTTCCACAC 180


11561R-1.IR_full       181 CGAAAAGGAGCTGAACGATAAGCTGAACGACTACTATGCCCTGAAGCACGTGCCCAAATG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     181 CGAAAAGGAGCTGAACGATAAGCTGAACGACTACTATGCCCTGAAGCACGTGCCCAAATG 240


11561R-1.IR_full       241 TTGGGCAGCTATACAGCCCTTTTTGTGCGCCGTCTTTAAGCCGAAGTGTGAAAAAATCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     241 TTGGGCAGCTATACAGCCCTTTTTGTGCGCCGTCTTTAAGCCGAAGTGTGAAAAAATCAA 300


11561R-1.IR_full       301 CGGCGAGGACATGGTCTACCTGCCATCTTACGAGATGTGCCGAATTACCATGGAACCCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     301 CGGCGAGGACATGGTCTACCTGCCATCTTACGAGATGTGCCGAATTACCATGGAACCCTG 360


11561R-1.IR_full       361 TCGCATTTTGTACAACACGACGTTTTTCCCAAAATTCCTTCGCTGCAACGAAACACTCTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     361 TCGCATTTTGTACAACACGACGTTTTTCCCAAAATTCCTTCGCTGCAACGAAACACTCTT 420


11561R-1.IR_full       421 TCCGACGAAATGCACAAACGGAGCACGAGGAATGAAATTCAACGGAACTGGCCAGTGTTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11561R-1.in silico     421 TCCGACGAAATGCACAAACGGAGCACGAGGAATGAAATTCAACGGAACTGGCCAGTGTTT 480


11561R-1.IR_full       481 AAGTCCTTTGGTTCCGACAG 500
                           ||||||||||||||||||||
11561R-1.in silico     481 AAGTCCTTTGGTTCCGACAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078719.2  CG11561-RA (smo), mRNA 
0   NM_137046.3  CG6191-RA (CG6191), mRNA 
0   NM_206188.1  CG30296-RA, transcript variant A (CG30296), mRNA 
0   NM_166418.1  CG30296-RD, transcript variant D (CG30296), mRNA 
0   NM_137693.1  CG30296-RC, transcript variant C (CG30296), mRNA 
0   NM_140687.4  CG6664-RA, transcript variant A (CG6664), mRNA 
0   NM_168710.3  CG6664-RC, transcript variant C (CG6664), mRNA 
0   NM_168709.3  CG6664-RB, transcript variant B (CG6664), mRNA 
0   NM_168711.2  CG6664-RD, transcript variant D (CG6664), mRNA 
0   NM_057659.2  CG9652-RA (DopR), mRNA 
0   NM_140963.1  CG5847-RA (CG5847), mRNA 
0   NM_165132.1  CG18109-RA (CG18109), mRNA 
0   NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_080051.2  CG1214-RA (ru), mRNA 
0   NM_001043185.1  CG12460-RA (CG12460), mRNA 
0   NM_167505.1  CG4211-RB, transcript variant B (nonA), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   NM_166742.1  CG31998-RA (CG31998), mRNA 
0   NM_001014750.1  CG7826-RD, transcript variant D (mnb), mRNA 
0   NM_170658.2  CG7826-RC, transcript variant C (mnb), mRNA 
0   NM_167581.2  CG7826-RA, transcript variant A (mnb), mRNA 
0   NM_164985.1  CG6756-RB, transcript variant B (Tom70), mRNA 
0   NM_167081.2  CG4094-RB, transcript variant B (l(1)G0255), mRNA 
0   NM_132111.2  CG4094-RA, transcript variant A (l(1)G0255), mRNA 
0   NM_079372.2  CG6215-RA (CkIIalpha-i1), mRNA 
0   NM_079123.2  CG4556-RA (eyc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.