National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11523R-4 
 Symbol CG11523  Full Name CG11523 
 CG No CG11523  Old CG No CG11523 
 Synonyms CG11523 
 Accession No (Link to NCBI) NM_141129.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tang HW, Spirohn K, Hu Y, Hao T, Kovács IA, Gao Y, Binari R, Yang-Zhou D, Wan KH, Bader JS, Balcha D, Bian W, Booth BW, Coté AG, de Rouck S, Desbuleux A, Goh KY, Kim DK, Knapp JJ, Lee WX, Lemmens I, Li C, Li M, Li R, Lim HJ, Liu Y, Luck K, Markey D, Pollis C, Rangarajan S, Rodiger J, Schlabach S, Shen Y, Sheykhkarimli D, TeeKing B, Roth FP, Tavernier J, Calderwood MA, Hill DE, Celniker SE, Vidal M, Perrimon N, Mohr SE.
Next-generation large-scale binary protein interaction network for Drosophila melanogaster.
Nat Commun (2023) 14(1) 2162 [ PubMed ID = 37061542 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAACCGAAAGCCACCGCAGAC 
 Primer Seq. 3'
aatctagaggtaccCTTCTTCTCCTCCTCCTCCGC 
 Predicted Fragment Size
468 
 IR fragment full Seq
0001 GAACCGAAAG CCACCGCAGA CCCTGGGGSA GGAGCAGGCC TTCAACTGCG AGGACGAAGC 
0061 CAACGCCATA TATTAACGAT GTTAAGGCTC ACGTCGCTGA GATTTGCATC TCATCCAAAC 
0121 TGGCAAGCGA TGCCACGCAA ATTTACCTGA ACATCCGGAC TATCGAGAGC GCCACTTGCT 
0181 GCGTTCAGGT GAGCAGTCGT GGCTTCAAGA TCGTCTCCTC CCAGTACGAC ACCATAGACG 
0241 AGGACAGCCG GATCTCTGCA CTGCTTCGCA ACGGACAAGA GCAAGGCGAC GACGAGGAGG 
0301 AGGAGATATT TGAAACGCCG TACGCGCTGC TGGACAAGAT CAGCCCCCGC TACGTCGAGT 
0361 CGTTCGGCAA CCAGCTGTGC CAGCAGCTTA GAGCGCTGCA ACAGATGCGA ACCGAGTTCA 
0421 ACGAGGAGGA CGAGGAGGAG GAGGAGGAGG CGGAGGAGGA GGAGAAGAAG  
 in silico PCR Fragment
0001 GAACCGAAAG CCACCGCAGA CCCTGGGG-A GGAGCAGGCC TTCAACTGCG AGGACGAAGC 
0061 CAACGCCATA -ATTAACGAT GTTAAGGCTC ACGTCGCTGA GATTTGCATC TCATCCAAAC 
0121 TGGCAAGCGA TGCCACGCAA ATTTACCTGA ACATCCGGAC TATCGAGAGC GCCACTTGCT 
0181 GCGTTCAGGT GAGCAGTCGT GGCTTCAAGA TCGTCTCCTC CCAGTACGAC ACCATAGACG 
0241 AGGACAGCCG GATCTCTGCA CTGCTTCGCA ACGGACAAGA GCAAGGCGAC GACGAGGAGG 
0301 AGGAGATATT TGAAACGCCG TACGCGCTGC TGGACAAGAT CAGCCCCCGC TACGTCGAGT 
0361 CGTTCGGCAA CCAGCTGTGC CAGCAGCTTA GAGCGCTGCA ACAGATGCGA ACCGAGTTCA 
0421 ACGAGGAGGA CGAGGAGGAG GAGGAGGAGG CGGAGGAGGA GGAGAAGAAG  
 Assemble Data

11523R-4.IR_full       1   GAACCGAAAGCCACCGCAGACCCTGGGGSAGGAGCAGGCCTTCAACTGCGAGGACGAAGC 60
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
11523R-4.in silico     1   GAACCGAAAGCCACCGCAGACCCTGGGG-AGGAGCAGGCCTTCAACTGCGAGGACGAAGC 60


11523R-4.IR_full       61  CAACGCCATATATTAACGATGTTAAGGCTCACGTCGCTGAGATTTGCATCTCATCCAAAC 120
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     61  CAACGCCATA-ATTAACGATGTTAAGGCTCACGTCGCTGAGATTTGCATCTCATCCAAAC 120


11523R-4.IR_full       121 TGGCAAGCGATGCCACGCAAATTTACCTGAACATCCGGACTATCGAGAGCGCCACTTGCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     121 TGGCAAGCGATGCCACGCAAATTTACCTGAACATCCGGACTATCGAGAGCGCCACTTGCT 180


11523R-4.IR_full       181 GCGTTCAGGTGAGCAGTCGTGGCTTCAAGATCGTCTCCTCCCAGTACGACACCATAGACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     181 GCGTTCAGGTGAGCAGTCGTGGCTTCAAGATCGTCTCCTCCCAGTACGACACCATAGACG 240


11523R-4.IR_full       241 AGGACAGCCGGATCTCTGCACTGCTTCGCAACGGACAAGAGCAAGGCGACGACGAGGAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     241 AGGACAGCCGGATCTCTGCACTGCTTCGCAACGGACAAGAGCAAGGCGACGACGAGGAGG 300


11523R-4.IR_full       301 AGGAGATATTTGAAACGCCGTACGCGCTGCTGGACAAGATCAGCCCCCGCTACGTCGAGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     301 AGGAGATATTTGAAACGCCGTACGCGCTGCTGGACAAGATCAGCCCCCGCTACGTCGAGT 360


11523R-4.IR_full       361 CGTTCGGCAACCAGCTGTGCCAGCAGCTTAGAGCGCTGCAACAGATGCGAACCGAGTTCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     361 CGTTCGGCAACCAGCTGTGCCAGCAGCTTAGAGCGCTGCAACAGATGCGAACCGAGTTCA 420


11523R-4.IR_full       421 ACGAGGAGGACGAGGAGGAGGAGGAGGAGGCGGAGGAGGAGGAGAAGAAG 470
                           ||||||||||||||||||||||||||||||||||||||||||||||||||
11523R-4.in silico     421 ACGAGGAGGACGAGGAGGAGGAGGAGGAGGCGGAGGAGGAGGAGAAGAAG 470

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   450  18  170  132  NM_141129.1  CG11523-RA (CG11523), mRNA 
2.22   10  11  78  63  NM_134584.2  CG32512-RA (CG32512), mRNA 
1.77   95  89  100  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
1.55   181  137  89  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
1.55   181  137  89  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
1.55   84  77  130  NM_167309.1  CG32663-RA (CG32663), mRNA 
1.33   68  72  90  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
1.33   66  137  188  NM_167340.1  CG32648-RA (Pde9), mRNA 
1.33   63  84  NM_137951.1  CG5357-RA (CG5357), mRNA 
1.11   59  124  119  NM_167620.2  CG32547-RA (CG32547), mRNA 
1.11   47  79  62  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
1.11   47  79  62  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
1.11   45  69  80  NM_136060.1  CG10348-RA (CG10348), mRNA 
1.11   29  73  101  NM_143338.2  CG12259-RA (CG12259), mRNA 
1.11   42  63  NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
1.11   42  63  NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
1.11   38  40  NM_141665.2  CG8348-RA (Dh), mRNA 
0.88   103  62  106  NM_135975.2  CG31781-RB (CG31781), mRNA 
0.88   67  44  65  NM_143222.1  CG14237-RA (CG14237), mRNA 
0.88   64  54  58  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0.88   23  56  64  NM_132645.2  CG15745-RA, transcript variant A (CG15745), mRNA 
0.88   23  56  64  NM_167357.1  CG15745-RB, transcript variant B (CG15745), mRNA 
0.88   22  48  60  NM_137995.2  CG18426-RA (ytr), mRNA 
0.88   11  57  83  NM_079007.2  CG17716-RA (fas), mRNA 
0.88   43  54  NM_176733.2  CG6299-RB, transcript variant B (CG6299), mRNA 
0.88   35  76  NM_136154.1  CG10631-RA (CG10631), mRNA 
0.88   31  31  NM_169458.1  CG11502-RA, transcript variant A (svp), mRNA 
0.66   93  88  195  NM_133114.2  CG32541-RA (CG32541), mRNA 
0.66   78  44  62  NM_176374.1  CG4761-RA (knrl), mRNA 
0.66   65  93  153  NM_133104.2  CG7282-RA (CG7282), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.