National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11438R-3 
 Symbol CG11438  Full Name CG11438 
 CG No CG11438  Old CG No CG11438 
 Synonyms Css1alpha, WUN-like, CG11438 
 Accession No (Link to NCBI) NM_141135.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGATCGTAGTGGTGGAGTTG 
 Primer Seq. 3'
aatctagaggtaccTAGTCGATGATCCGAGTCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGATCGTAG TGGTGGAGTT GTTTAGGCAG CTGcCCGGTG GgcCGCTTAG AGAGGCGGGC 
0061 GGTAAGcGGG ATAGCTGCCG GATagCCCAC CGCCTCGGGG TCCTTTATCG CCAGGTTATC 
0121 TTCTACCTGT ACGGCCTCGc CATGGTCACG TTCACCACGA TGCTGACGAA GCTGTGCCTC 
0181 GGGGGTCTGC GACCGCACTT CCTCGCCGTG TGCCAGCCCA TGCTGCCGGA CGGAAGCAGC 
0241 TGCCAGGACG CCCAGAACCT GGGACGCTAC ATAGACAGTT TTACGTGCAG CAACGCCAAC 
0301 ATGACCGACT ACCAGTTCAA GGAGCTCTAC CAGTCCTTCC CAAGCGGCCA CGCCAGCATT 
0361 GCCATGTATG CTATGCTCTA CCTGGCCATC TACCTGCAGG CGGCGCTCAG TACGCGCGTC 
0421 TCCAAGCTGC TGAAGCATCT GCTGCAGTTC CTCTTCGTCA TGTTCGGCTG GTACGTATCG 
0481 CTGACTCGGA TCATCGACTA  
 in silico PCR Fragment
0001 GTGATCGTAG TGGTGGAGTT GTTTAGGCAG CTGCCCGGTG GGCCGCTTAG AGAGGCGGGC 
0061 GGTAAGCGGG ATAGCTGCCG GATAGCCCAC CGCCTCGGGG TCCTTTATCG CCAGGTTATC 
0121 TTCTACCTGT ACGGCCTCGC CATGGTCACG TTCACCACGA TGCTGACGAA GCTGTGCCTC 
0181 GGGCGTCTGC GACCGCACTT CCTCGCCGTG TGCCAGCCCA TGCTGCCGGA CGGAAGCAGC 
0241 TGCCAGGACG CCCAGAACCT GGGACGCTAC ATAGACAGTT TTACGTGCAG CAACGCCAAC 
0301 ATGACCGACT ACCAGTTCAA GGAGCTCTAC CAGTCCTTCC CAAGCGGCCA CGCCAGCATG 
0361 GCCATGTATG CTATGCTCTA CCTGGCCATC TACCTGCAGG CGGCGCTCAG TACGCGCGTC 
0421 TCCAAGCTGC TGAAGCATCT GCTGCAGTTC CTCTTCGTCA TGTTCGGCTG GTACGTATCG 
0481 CTGACTCGGA TCATCGACTA  
 Assemble Data

11438R-3.IR_full        1   TGATCGTAGTGGTGGAGTTGTTTAGGCAGCTGCCCGGTGGGCCGCTTAGAGAGGCGGGC 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico      1   TGATCGTAGTGGTGGAGTTGTTTAGGCAGCTGCCCGGTGGGCCGCTTAGAGAGGCGGGC 59


11438R-3.IR_full       61  GGTAAGCGGGATAGCTGCCGGATAGCCCACCGCCTCGGGGTCCTTTATCGCCAGGTTATC 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     61  GGTAAGCGGGATAGCTGCCGGATAGCCCACCGCCTCGGGGTCCTTTATCGCCAGGTTATC 119


11438R-3.IR_full       121 TTCTACCTGTACGGCCTCGCCATGGTCACGTTCACCACGATGCTGACGAAGCTGTGCCTC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     121 TTCTACCTGTACGGCCTCGCCATGGTCACGTTCACCACGATGCTGACGAAGCTGTGCCTC 179


11438R-3.IR_full       181 GGGGGTCTGCGACCGCACTTCCTCGCCGTGTGCCAGCCCATGCTGCCGGACGGAAGCAGC 239
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     181 GGGCGTCTGCGACCGCACTTCCTCGCCGTGTGCCAGCCCATGCTGCCGGACGGAAGCAGC 239


11438R-3.IR_full       241 TGCCAGGACGCCCAGAACCTGGGACGCTACATAGACAGTTTTACGTGCAGCAACGCCAAC 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     241 TGCCAGGACGCCCAGAACCTGGGACGCTACATAGACAGTTTTACGTGCAGCAACGCCAAC 299


11438R-3.IR_full       301 ATGACCGACTACCAGTTCAAGGAGCTCTACCAGTCCTTCCCAAGCGGCCACGCCAGCATT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
11438R-3.in silico     301 ATGACCGACTACCAGTTCAAGGAGCTCTACCAGTCCTTCCCAAGCGGCCACGCCAGCATG 359


11438R-3.IR_full       361 GCCATGTATGCTATGCTCTACCTGGCCATCTACCTGCAGGCGGCGCTCAGTACGCGCGTC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     361 GCCATGTATGCTATGCTCTACCTGGCCATCTACCTGCAGGCGGCGCTCAGTACGCGCGTC 419


11438R-3.IR_full       421 TCCAAGCTGCTGAAGCATCTGCTGCAGTTCCTCTTCGTCATGTTCGGCTGGTACGTATCG 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11438R-3.in silico     421 TCCAAGCTGCTGAAGCATCTGCTGCAGTTCCTCTTCGTCATGTTCGGCTGGTACGTATCG 479


11438R-3.IR_full       481 CTGACTCGGATCATCGACTA 499
                           ||||||||||||||||||||
11438R-3.in silico     481 CTGACTCGGATCATCGACTA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141135.2  CG11438-RA (CG11438), mRNA 
0   NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_143355.1  CG12852-RA (CG12852), mRNA 
0   NM_166475.1  CG30290-RA (CG30290), mRNA 
0   NM_142988.2  CG5728-RA (CG5728), mRNA 
0   NM_001042878.1  CG13784-RC, transcript variant C (CG13784), mRNA 
0   NM_140231.1  CG6071-RA (CG6071), mRNA 
0   15  11  NM_141137.1  CG11426-RA (CG11426), mRNA 
0   21  NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_078687.1  CG12529-RA, transcript variant A (Zw), mRNA 
0   NM_169213.1  CG7508-RA (ato), mRNA 
0   NM_138269.1  CG12086-RA (cue), mRNA 
0   NM_078688.2  CG14226-RA (dome), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   NM_166047.1  CG8603-RB, transcript variant B (CG8603), mRNA 
0   NM_137108.2  CG8603-RA, transcript variant A (CG8603), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_141318.2  CG2104-RA (CG2104), mRNA 
0   NM_165509.1  CG11084-RB, transcript variant B (pk), mRNA 
0   NM_165508.1  CG11084-RA, transcript variant A (pk), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_080256.2  CG13057-RA (retinin), mRNA 
0   11  NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_142817.1  CG17622-RA (CG17622), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.