National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11420R-3 
 Symbol png  Full Name pan gu 
 CG No CG11420  Old CG No CG11420 
 Synonyms Png, EG:8D8.5, PNG, CG11420, fs(1)M2, pan-gnu, png 
 Accession No (Link to NCBI) NM_058144.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTGCGTGAAGCGGATCATCG 
 Primer Seq. 3'
aatctagaggtaccCTCGTAGAGGACTAGCCCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTGCGTGAA GCGGATCATC GTCCGGAATC CGAAGACAGA GTTGGGATTG ATCAAGGAGG 
0061 AGGTGTACAT CATCTCGCAG CTGCGCCACC CGCACATCGT TGAGTTCCTG CGCTCCTTTA 
0121 GCCACGCGGG CACTGTGAAC ATCGTGATGG AGTACGTGCC CAACGGCACC TTGAGGGATG 
0181 TCATCCAGCA GCTGCCGTCA GGCACCGGGG GAGTCAATCA GGAGCGGCTG ATGGGCTACT 
0241 TCCGCGACAT GGTAGTGGGA CTCGAGTACC TGCACATCCG CTGCGTCATC CACCGAGACA 
0301 TCAAGCCCGA GAACATGCTC CTCGACGCCA ACGACCGCGT CAAGATCGCC GACTTTGGGA 
0361 TCGCGAACGT TCATGCGCCC AGCACTCAAC TGCAGGCGGG CATGGGCACG CCCATGTTAC 
0421 ATGGCCCCGG AGGCGATGTC CAGCCAGGGC AAGGTGGATT TCAAGTCGGA CGTGTGGTCA 
0481 CTGGGGCTAG TCCTCTACGA G 
 in silico PCR Fragment
0001 TGTGCGTGAA GCGGATCATC GTCCGGAATC CGAAGACAGA GTTGGGATTG ATCAAGGAGG 
0061 AGGTGTACAT CATCTCGCAG CTGCGCCACC CGCACATCGT TGAGTTCCTG CGCTCCTTTA 
0121 GCCACGCGGG CACTGTGAAC ATCGTGATGG AGTACGTGCC CAACGGCACC TTGAGGGATG 
0181 TCATCCAGCA GCTGCCGTCA GGCACCGGGG GAGTCAATCA GGAGCGGCTG ATGGGCTACT 
0241 TCCGCGACAT GGTAGTGGGA CTCGAGTACC TGCACATCCG CTGCGTCATC CACCGAGACA 
0301 TCAAGCCCGA GAACATGCTC CTCGACGCCA ACGACCGCGT CAAGATCGCC GACTTTGGGA 
0361 TCGCGAACGT TCATGCGCCC AGCACTCAAC TGCAGGCGGG CATGGGCACG CCCATG-TAC 
0421 ATGGCCCCGG AGGCGATGTC CAGCCAGGGC AAGGTGGATT TCAAGTCGGA CGTGTGGTCA 
0481 CTGGGGCTAG TCCTCTACGA G 
 Assemble Data

11420R-3.IR_full       1   TGTGCGTGAAGCGGATCATCGTCCGGAATCCGAAGACAGAGTTGGGATTGATCAAGGAGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     1   TGTGCGTGAAGCGGATCATCGTCCGGAATCCGAAGACAGAGTTGGGATTGATCAAGGAGG 60


11420R-3.IR_full       61  AGGTGTACATCATCTCGCAGCTGCGCCACCCGCACATCGTTGAGTTCCTGCGCTCCTTTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     61  AGGTGTACATCATCTCGCAGCTGCGCCACCCGCACATCGTTGAGTTCCTGCGCTCCTTTA 120


11420R-3.IR_full       121 GCCACGCGGGCACTGTGAACATCGTGATGGAGTACGTGCCCAACGGCACCTTGAGGGATG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     121 GCCACGCGGGCACTGTGAACATCGTGATGGAGTACGTGCCCAACGGCACCTTGAGGGATG 180


11420R-3.IR_full       181 TCATCCAGCAGCTGCCGTCAGGCACCGGGGGAGTCAATCAGGAGCGGCTGATGGGCTACT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     181 TCATCCAGCAGCTGCCGTCAGGCACCGGGGGAGTCAATCAGGAGCGGCTGATGGGCTACT 240


11420R-3.IR_full       241 TCCGCGACATGGTAGTGGGACTCGAGTACCTGCACATCCGCTGCGTCATCCACCGAGACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     241 TCCGCGACATGGTAGTGGGACTCGAGTACCTGCACATCCGCTGCGTCATCCACCGAGACA 300


11420R-3.IR_full       301 TCAAGCCCGAGAACATGCTCCTCGACGCCAACGACCGCGTCAAGATCGCCGACTTTGGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     301 TCAAGCCCGAGAACATGCTCCTCGACGCCAACGACCGCGTCAAGATCGCCGACTTTGGGA 360


11420R-3.IR_full       361 TCGCGAACGTTCATGCGCCCAGCACTCAACTGCAGGCGGGCATGGGCACGCCCATGTTAC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
11420R-3.in silico     361 TCGCGAACGTTCATGCGCCCAGCACTCAACTGCAGGCGGGCATGGGCACGCCCATG-TAC 420


11420R-3.IR_full       421 ATGGCCCCGGAGGCGATGTCCAGCCAGGGCAAGGTGGATTTCAAGTCGGACGTGTGGTCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11420R-3.in silico     421 ATGGCCCCGGAGGCGATGTCCAGCCAGGGCAAGGTGGATTTCAAGTCGGACGTGTGGTCA 480


11420R-3.IR_full       481 CTGGGGCTAGTCCTCTACGAG 501
                           |||||||||||||||||||||
11420R-3.in silico     481 CTGGGGCTAGTCCTCTACGAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058144.2  CG11420-RA (png), mRNA 
0.2   NM_057848.2  CG5072-RB, transcript variant B (Cdk4), mRNA 
0.2   NM_166184.1  CG5072-RA, transcript variant A (Cdk4), mRNA 
0.2   NM_166185.1  CG5072-RC, transcript variant C (Cdk4), mRNA 
0.2   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0.2   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0.2   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0.2   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0.2   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0.2   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0.2   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   18  NM_206604.1  CG3051-RC, transcript variant C (SNF1A), mRNA 
0   18  NM_057965.3  CG3051-RA, transcript variant A (SNF1A), mRNA 
0   18  NM_166880.1  CG3051-RB, transcript variant B (SNF1A), mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   17  NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   17  NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   17  NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   17  NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   17  NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   17  NM_167794.1  CG1210-RE, transcript variant E (Pk61C), mRNA 
0   17  NM_167795.1  CG1210-RG, transcript variant G (Pk61C), mRNA 
0   17  NM_167793.1  CG1210-RB, transcript variant B (Pk61C), mRNA 
0   NM_165452.1  CG7873-RB, transcript variant B (Src42A), mRNA 
0   NM_057501.3  CG7873-RA, transcript variant A (Src42A), mRNA 
0   NM_132502.1  CG11697-RA (CG11697), mRNA 
0   10  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_142387.1  CG7643-RA (ald), mRNA 
0   10  NM_141279.2  CG12147-RA (CG12147), mRNA 
0   NM_001043201.1  CG32944-RC, transcript variant C (CG32944), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.