National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11420R-3 
 Symbol png  Full Name pan gu 
 CG No CG11420  Old CG No CG11420 
 Synonyms Png, EG:8D8.5, PNG, CG11420, fs(1)M2, pan-gnu, png 
 Accession No (Link to NCBI) NM_058144.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTGCGTGAAGCGGATCATCGTCCGGAATCCGAAGACAGAGTTGGGATTGATCAAGGAGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGGTGTACATCATCTCGCAGCTGCGCCACCCGCACATCGTTGAGTTCCTGCGCTCCTTTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCACGCGGGCACTGTGAACATCGTGATGGAGTACGTGCCCAACGGCACCTTGAGGGATG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCATCCAGCAGCTGCCGTCAGGCACCGGGGGAGTCAATCAGGAGCGGCTGATGGGCTACT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCGCGACATGGTAGTGGGACTCGAGTACCTGCACATCCGCTGCGTCATCCACCGAGACA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCAAGCCCGAGAACATGCTCCTCGACGCCAACGACCGCGTCAAGATCGCCGACTTTGGGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     361 TCGCGAACGTTCATGCGCCCAGCACTCAACTGCAGGCGGGCATGGGCACGCCCATG-TAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGGCCCCGGAGGCGATGTCCAGCCAGGGCAAGGTGGATTTCAAGTCGGACGTGTGGTCA 480

11420R-3.IR_full       481 CTGGGGCTAGTCCTCTACGAG 501
                           ||||||||||||||||||||| silico     481 CTGGGGCTAGTCCTCTACGAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058144.2  CG11420-RA (png), mRNA 
0.2   NM_057848.2  CG5072-RB, transcript variant B (Cdk4), mRNA 
0.2   NM_166184.1  CG5072-RA, transcript variant A (Cdk4), mRNA 
0.2   NM_166185.1  CG5072-RC, transcript variant C (Cdk4), mRNA 
0.2   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0.2   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0.2   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0.2   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0.2   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0.2   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0.2   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   18  NM_206604.1  CG3051-RC, transcript variant C (SNF1A), mRNA 
0   18  NM_057965.3  CG3051-RA, transcript variant A (SNF1A), mRNA 
0   18  NM_166880.1  CG3051-RB, transcript variant B (SNF1A), mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   17  NM_167789.1  CG1210-RC, transcript variant C (Pk61C), mRNA 
0   17  NM_167791.1  CG1210-RF, transcript variant F (Pk61C), mRNA 
0   17  NM_167792.1  CG1210-RH, transcript variant H (Pk61C), mRNA 
0   17  NM_080382.2  CG1210-RA, transcript variant A (Pk61C), mRNA 
0   17  NM_167790.1  CG1210-RD, transcript variant D (Pk61C), mRNA 
0   17  NM_167794.1  CG1210-RE, transcript variant E (Pk61C), mRNA 
0   17  NM_167795.1  CG1210-RG, transcript variant G (Pk61C), mRNA 
0   17  NM_167793.1  CG1210-RB, transcript variant B (Pk61C), mRNA 
0   NM_165452.1  CG7873-RB, transcript variant B (Src42A), mRNA 
0   NM_057501.3  CG7873-RA, transcript variant A (Src42A), mRNA 
0   NM_132502.1  CG11697-RA (CG11697), mRNA 
0   10  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_142387.1  CG7643-RA (ald), mRNA 
0   10  NM_141279.2  CG12147-RA (CG12147), mRNA 
0   NM_001043201.1  CG32944-RC, transcript variant C (CG32944), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.