National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11418R-1 
 Symbol CG11418  Full Name CG11418 
 CG No CG11418  Old CG No CG11418 
 Synonyms EG:8D8.8, DmNP_569904, CG11418 
 Accession No (Link to NCBI) NM_130548.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bratic A, Clemente P, Calvo-Garrido J, Maffezzini C, Felser A, Wibom R, Wedell A, Freyer C, Wredenberg A.
Mitochondrial Polyadenylation Is a One-Step Process Required for mRNA Integrity and tRNA Maturation.
PLoS Genet. (2016) 12(5) e1006028 [ PubMed ID = 27176048 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACAATGCTTCAGAGGCGGCT 
 Primer Seq. 3'
aatctagaggtaccTCATTCAGGCGCGTGTGCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACAATGCTT CAGAGGCGGC TTCTCCCGGA CGGAACGCAA GCAGGCCCAA CTACGAGGAG 
0061 TTCATTGGCC GTCATCAGCG ACAGGCCCAG TGCAGCATTG TGGTCCAGGT GAGCTCCGAA 
0121 AAGTCGTATG AGGAGTTGTA TAACTACTGC AGCAGCTTCG GCTCGATCAT GGGTGCCCAC 
0181 CACTACTGCG TGCGGCAGGA CGAGACCCTG CACTACATCC TGCTGGAGTA CGCCACGTCG 
0241 GACGAGGCGG CGGCTGCCAT CGGAGCGGGC GTTACCAATG GCGAGCTGAG CGGCGTGCCC 
0301 GTGCGATCTC CCTTTCTGTG GTTCCGGGCA GCGGGAGGAG GCAGACGGAG CCCCAAGCTA 
0361 GTTGCCAATA CAGCGCCCGC ACTGCTATCC TTGGACGGCA CCCGGCAGGT GGATCAGCGC 
0421 CACCTACTGG GGCTCTTACG TGGTGCAGCG GACATCGAAG AGCAGGTGCA GCAGCTTGTA 
0481 CGAGCACACG CGCCTGAATG A 
 in silico PCR Fragment
0001 CACAATGCTT CAGAGGCGGC TTCTCCCGGA CGGAACGCAG GCAGGCCCAA CTACGAGGAG 
0061 TTCATTGGCC GTCATCAGCG ACAGGCCCAG TGCAGCATTG TGGTCCAGGT GAGCTCCGAA 
0121 AAGTCGTATG AGGAGTTGTA TAACTACTGC AGCAGCTTCG GCTCGATCAT GGGTGCCCAC 
0181 CACTACTGCG TGCGGCAGGA CGAGACCCTG CACTACATCC TGCTGGAGTA CGCCACGTCG 
0241 GACGAGGCGG CGGCTGCCAT CGGAGCGGGC GTTACCAATG GCGAGCTGAG CGGCGTGCCC 
0301 GTGCGATCTC CCTTTCTGTG GTTCCGGGCA GCGGGAGGAG GCAGACGGAG CCCCAAGCTA 
0361 GTTGCCAATA CAGCGCCCGC ACTGCTATCC TTGGACGGCA CCCGGCAGGT GGATCAGCGC 
0421 CACCTACTGG GGCTCTTACG TGGTGCAGCG GACATCGAAG AGCAGGTGCA GCAGC-TGTA 
0481 CGAGCACACG CGCCTGAATG A 
 Assemble Data

11418R-1.IR_full       1   CACAATGCTTCAGAGGCGGCTTCTCCCGGACGGAACGCAAGCAGGCCCAACTACGAGGAG 60
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
11418R-1.in silico     1   CACAATGCTTCAGAGGCGGCTTCTCCCGGACGGAACGCAGGCAGGCCCAACTACGAGGAG 60


11418R-1.IR_full       61  TTCATTGGCCGTCATCAGCGACAGGCCCAGTGCAGCATTGTGGTCCAGGTGAGCTCCGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     61  TTCATTGGCCGTCATCAGCGACAGGCCCAGTGCAGCATTGTGGTCCAGGTGAGCTCCGAA 120


11418R-1.IR_full       121 AAGTCGTATGAGGAGTTGTATAACTACTGCAGCAGCTTCGGCTCGATCATGGGTGCCCAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     121 AAGTCGTATGAGGAGTTGTATAACTACTGCAGCAGCTTCGGCTCGATCATGGGTGCCCAC 180


11418R-1.IR_full       181 CACTACTGCGTGCGGCAGGACGAGACCCTGCACTACATCCTGCTGGAGTACGCCACGTCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     181 CACTACTGCGTGCGGCAGGACGAGACCCTGCACTACATCCTGCTGGAGTACGCCACGTCG 240


11418R-1.IR_full       241 GACGAGGCGGCGGCTGCCATCGGAGCGGGCGTTACCAATGGCGAGCTGAGCGGCGTGCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     241 GACGAGGCGGCGGCTGCCATCGGAGCGGGCGTTACCAATGGCGAGCTGAGCGGCGTGCCC 300


11418R-1.IR_full       301 GTGCGATCTCCCTTTCTGTGGTTCCGGGCAGCGGGAGGAGGCAGACGGAGCCCCAAGCTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     301 GTGCGATCTCCCTTTCTGTGGTTCCGGGCAGCGGGAGGAGGCAGACGGAGCCCCAAGCTA 360


11418R-1.IR_full       361 GTTGCCAATACAGCGCCCGCACTGCTATCCTTGGACGGCACCCGGCAGGTGGATCAGCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11418R-1.in silico     361 GTTGCCAATACAGCGCCCGCACTGCTATCCTTGGACGGCACCCGGCAGGTGGATCAGCGC 420


11418R-1.IR_full       421 CACCTACTGGGGCTCTTACGTGGTGCAGCGGACATCGAAGAGCAGGTGCAGCAGCTTGTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
11418R-1.in silico     421 CACCTACTGGGGCTCTTACGTGGTGCAGCGGACATCGAAGAGCAGGTGCAGCAGC-TGTA 480


11418R-1.IR_full       481 CGAGCACACGCGCCTGAATGA 501
                           |||||||||||||||||||||
11418R-1.in silico     481 CGAGCACACGCGCCTGAATGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130548.2  CG11418-RA, transcript variant A (CG11418), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_135121.2  CG8965-RA (CG8965), mRNA 
0   NM_135348.2  CG8451-RA (CG8451), mRNA 
0   12  NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   12  NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_131934.1  CG3626-RA (CG3626), mRNA 
0   NM_135573.2  CG7384-RA (CG7384), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_057568.4  CG14025-RA, transcript variant A (Bsg25D), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_133143.1  CG8002-RA (rictor), mRNA 
0   NM_164692.2  CG31638-RA (CG31638), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_169088.1  CG1250-RA, transcript variant A (sec23), mRNA 
0   NM_136057.1  CG10373-RA (CG10373), mRNA 
0   22  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
0   NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0   NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
0   NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
0   NM_169118.1  CG10279-RD, transcript variant D (Rm62), mRNA 
0   NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 
0   NM_001014557.1  CG33545-RA (nab), mRNA 
0   NM_139823.1  CG14825-RA (BBS1), mRNA 
0   NM_136594.1  CG8172-RA (CG8172), mRNA 
0   NM_140795.2  CG4120-RA (Cyp12c1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.