National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11388R-1 
 Symbol CG11388  Full Name CG11388 
 CG No CG11388  Old CG No CG11388 
 Synonyms anon-EST:Posey287, CG11388 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCCGCCAGAAGCCGAAGAGT 
 Primer Seq. 3'
aatctagaggtaccAACCGCCTGATCTGTCGCTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11388R-1.IR full       1   ATCCGCCAGAAGCCGAAGAGTTGGGCTTGGACCCTGCTGCGTTGCAGGTGGCAAAAGAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11388R-1.in silico     1   ATCCGCCAGAAGCCGAAGAGTTGGGCTTGGACCCTGCTGCGTTGCAGGTGGCAAAAGAAG 60


11388R-1.IR full       61  CTAGTTCTCTTATTAATATTTATTTGTGTGTGCGNTCTAATTGTTTTCGCCAACACGCAT 120
                           |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||
11388R-1.in silico     61  CTAGTTCTCTTATTAATATTTATTTGTGTGTGCGTTCTGATTGTTTTCGCCAACACGCAT 120


11388R-1.IR full       121 CTCTTGGTTCGCGGCAACATCCTCTCGGCCTTCCTCTCGAGCCGGCTTAACAAGCATTCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11388R-1.in silico     121 CTCTTGGTTCGCGGCAACATCCTCTCGGCCTTCCTCTCGAGCCGGCTTAACAAGCATTCG 180


11388R-1.IR full       181 CACGCGGAGAAGCAGGAGGCGAGGTATCCCGACATCCCGGCCACGACCCCGTCAGTTCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11388R-1.in silico     181 CACGCGGAGAAGCAGGAGGCGAGGTATCCCGACATCCCGGCCACGACCCCGTCAGTTCCC 240


11388R-1.IR full       241 CCGGTGCTGAGGCCCACGCACTATCTGCTCAACTACTCCTCCACCCAGCTGGAGCTGAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11388R-1.in silico     241 CCGGTGCTGAGGCCCACGCACTATCTGCTCAACTACTCCTCCACCCAGCTGGAGCTGAGC 300


11388R-1.IR full       301 TCGCACTTGAACGGNCTGTCCTCGGACTACAACATATTCGTCATCTACACGCGGGAGAAC 360
                           |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||
11388R-1.in silico     301 TCGCACTTGAACGGTCTGTCCTCAGACTACAACATATTCGTCATCTACACGCGGGAGAAC 360


11388R-1.IR full       361 TACCACTTGAACCTTAAGTTCGACCTGTTCGCCCACAGCTTGCTGAAGNACACCAGTGCC 420
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
11388R-1.in silico     361 TACCACTTGAACCTTAAGTTCGACCTGTTCGCCCACAGCTTGCTGAAGCACACCAGTGCC 420


11388R-1.IR full       421 CAGCTGCATCTGCACGTGATCACGGACAGCGAGAGNCAGCCCTCGGTGCTGGAGATCCTG 480
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
11388R-1.in silico     421 CAGCTGCATCTGCACGTGATCACGGACAGCGAGAGCCAGCCCTCGGTGCTGGAGATCCTG 480


11388R-1.IR full       481 CAGCGACAGATCAG------ 500
                           ||||||||||||||      
11388R-1.in silico     481 CAGCGACAGATCAGGCGGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_138027.2  CG11388-RA (CG11388), mRNA 
NM_057376.2  schnurri CG7734-RC, transcript variant C (shn), mRNA 
NM_134279.2  schnurri CG7734-RB, transcript variant B (shn), mRNA 
NM_057375.3  schnurri CG7734-RA, transcript variant A (shn), mRNA 
NM_206091.1  schnurri CG7734-RD, transcript variant D (shn), mRNA 
NM_057313.3  okra CG3736-RA (okr), mRNA 
NM_136518.3  CG2183-RA (CG2183), mRNA 
NM_132155.2  CG4617-RA (CG4617), mRNA 
NM_079126.2  Cytochrome P450-9c1 CG3616-RA (Cyp9c1), mRNA 
NM_057579.3  DEAD box protein 45A CG12759-RA (Dbp45A), mRNA 
NM_080223.2  Chitinase 4 CG3986-RA (Cht4), mRNA 
NM_134730.2  Tfb4 CG5041-RA (Tfb4), mRNA 
NM_132877.1  CG8958-RA (CG8958), mRNA 
NM_169697.2  pannier CG3978-RB, transcript variant B (pnr), mRNA 
NM_138089.2  origami CG11416-RA (ori), mRNA 
NM_135550.1  CG5362-RA (CG5362), mRNA 
NM_167557.2  meiotic 218 CG8923-RB, transcript variant B (mei-218), mRNA 
NM_001031897.1  CG8923-RC, transcript variant C (mei-218), mRNA 
NM_001031898.1  mei-217 CG33935-RA, transcript variant A (mei-217), mRNA 
NM_139986.2  CG6282-RA, transcript variant A (CG6282), mRNA 
NM_176302.1  CG6282-RB, transcript variant B (CG6282), mRNA 
NM_079352.2  Proteasome beta2 subunit CG3329-RA (Prosbeta2), mRNA 
NM_141633.1  CG8135-RA (CG8135), mRNA 
NM_137595.1  isopeptidase-T-3 CG11025-RA, transcript variant A (isopeptidase-T-3), mRNA 
NM_166373.2  isopeptidase-T-3 CG11025-RB, transcript variant B (isopeptidase-T-3), mRNA 
NM_137144.2  Sprouty-related protein with EVH-1 domain CG10155-RA (Spred), mRNA 
NM_141124.1  CG15374-RA (CG15374), mRNA 
NM_206488.1  CG3563-RB, transcript variant B (CG3563), mRNA 
12  NM_078684.2  pacman CG3291-RA (pcm), mRNA 
NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.