National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11357R-1 
 Symbol CG11357  Full Name CG11357 
 CG No CG11357  Old CG No CG11357 
 Synonyms BcDNA:GM04393, CG11357 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGATCGTTGTGCCTGCTGC 
 Primer Seq. 3'
aatctagaggtaccCTTCAGCGGCGTCTGGTCTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11357R-1.IR full       1   AGCGATCGTTGTGCCTGCTGCTCATCTGCATCAATCTGTGCCTGGTCATCTGGCTGGTCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11357R-1.in silico     1   AGCGATCGTTGTGCCTGCTGCTCATCTGCATCAATCTGTGCCTGGTCATCTGGCTGGTCA 60


11357R-1.IR full       61  GTGTGCAGCAGTTAGCNGATGCTGGAAN-GGAAATCATCGCCGATTTTAGCGGAAGTGGC 120
                           ||||||||||||| || ||||||||||  |||||||||||||||||||||||||||||||
11357R-1.in silico     61  GTGTGCAGCAGTT-GCCGATGCTGGAAGCGGAAATCATCGCCGATTTTAGCGGAAGTGGC 120


11357R-1.IR full       121 GGCATTAG-AGCAGCAGCACCGCACAGCCGCCAACGAGTGCCAAAAGTGGATTGCGGAGG 180
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
11357R-1.in silico     121 GGCATTAGCAGCAGCAGCACCGCACAGCCGCCAACGAGTGCCAAAAGTGGATTGCGGAGG 180


11357R-1.IR full       181 AGCAGGAGCCAACCAAACCAAATACACCAGCCTAGTCGCACACCTAGTAATAGTAATGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11357R-1.in silico     181 AGCAGGAGCCAACCAAACCAAATACACCAGCCTAGTCGCACACCTAGTAATAGTAATGAT 240


11357R-1.IR full       241 AGTAGCCTAGTTAGCAACACATTCGATAACCACCCCATGGNCACGCCCCCCACTTTGGCG 300
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
11357R-1.in silico     241 AGTAGCCTAGTTAGCAACACATTCGATAACCACCCCATGGGCACGCCCCCCACTTTGGCG 300


11357R-1.IR full       301 TCACAAACGCCCACGCCGCCACAGAGCAGCATGCACCTCATGGATCTGCCCAATTTCGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11357R-1.in silico     301 TCACAAACGCCCACGCCGCCACAGAGCAGCATGCACCTCATGGATCTGCCCAATTTCGTC 360


11357R-1.IR full       361 TATCTAATAGACCAGCCCGCCTGTGATAAGGATGTCCGGGCACTGATATTGGTNCATTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| 
11357R-1.in silico     361 TATCTAATAGACCAGCCCGCCTGTGATAAGGATGTCCGGGCACTGATATTGGTCCATTCG 420


11357R-1.IR full       421 TCAGTGCGCAATATCGAAAAGCGCCGGATCATCCGAGAAACGTGTGGCGAATCGGAGCTA 480
                            |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||
11357R-1.in silico     421 GCAGTGCGCAATATCGAAAAGCGCCGGATAATCCGAGAAACGTG-GGCGAATCGGAGCTA 480


11357R-1.IR full       481 TATAGACCAGACGCCGCTGAAGG 503
                           |||||||||||||||||||||| 
11357R-1.in silico     481 TATAGACCAGACGCCGCTGAAG- 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_139659.1  CG11357-RA (CG11357), mRNA 
0.41  NM_079268.2  Kinesin-like protein at 67A CG10923-RA (Klp67A), mRNA 
25  NM_141280.2  CG14669-RA (CG14669), mRNA 
NM_057346.3  asense CG3258-RA (ase), mRNA 
NM_142425.2  cadmus CG7212-RA (cdm), mRNA 
11  NM_167402.1  narrow abdomen CG1517-RC, transcript variant C (na), mRNA 
11  NM_167401.1  narrow abdomen CG1517-RB, transcript variant B (na), mRNA 
10  NM_080303.2  wings apart-like CG3707-RA, transcript variant A (wapl), mRNA 
NM_166931.1  wings apart-like CG3707-RB, transcript variant B (wapl), mRNA 
12  NM_136724.1  CG12911-RA (CG12911), mRNA 
NM_137605.2  CG13872-RA (CG13872), mRNA 
10  106  NM_166030.1  mastermind CG8118-RB, transcript variant B (mam), mRNA 
10  106  NM_080376.1  mastermind CG8118-RA, transcript variant A (mam), mRNA 
17  NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
NM_136505.2  CG8713-RA (CG8713), mRNA 
20  NM_166961.1  dunce CG32498-RI, transcript variant I (dnc), mRNA 
20  NM_166965.1  dunce CG32498-RJ, transcript variant J (dnc), mRNA 
20  NM_166963.1  dunce CG32498-RK, transcript variant K (dnc), mRNA 
20  NM_166964.1  dunce CG32498-RD, transcript variant D (dnc), mRNA 
20  NM_166962.1  dunce CG32498-RC, transcript variant C (dnc), mRNA 
15  NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
NM_132794.2  CG18210-RA (CG18210), mRNA 
NM_134689.1  CG2794-RA (CG2794), mRNA 
NM_134478.1  CG14219-RA (CG14219), mRNA 
NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
15  27  NM_136857.2  thisbe CG12443-RA (ths), mRNA 
35  NM_078516.2  Checkpoint suppressor homologue CG12690-RA (CHES-1-like), mRNA 
12  NM_135199.2  CG31637-RA (CG31637), mRNA 
NM_168725.2  CG13731-RA (CG13731), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.