National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11340R-3 
 Symbol CG11340  Full Name CG11340 
 CG No CG11340  Old CG No CG11340 
 Synonyms CG11340 
 Accession No (Link to NCBI) NM_143604.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Redhai S, Pilgrim C, Gaspar P, Giesen LV, Lopes T, Riabinina O, Grenier T, Milona A, Chanana B, Swadling JB, Wang YF, Dahalan F, Yuan M, Wilsch-Brauninger M, Lin WH, Dennison N, Capriotti P, Lawniczak MKN, Baines RA, Warnecke T, Windbichler N, Leulier F, Bellono NW, Miguel-Aliaga I.
An intestinal zinc sensor regulates food intake and developmental growth.
Nature (2020) 580(7802) 263-268 [ PubMed ID = 32269334 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGACCTGCAGTTTACGGTG 
 Primer Seq. 3'
aatctagaggtaccATGCTGTAGTTGCCCTCCAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTGACCTGC AGTTTACGGT GCAGGGTCTG CTGCAGTTGC GATACTTGGA CCCGCGCCTG 
0061 GCCTTCTCCA GCTATCTGCC CAACCGAAGG CAGCCCATAA TGGGGGAGTC GGAACTGAAG 
0121 AAGATGCTCT GGGTGCCACA TATATTCCTG ACCAACGAAC AGGCCTCCAC TGTCCTGGGC 
0181 ACCAGCGCCA AGGACGAGCT GACCAGCATT TATCCGAATG GCACAGTTCT GACATCCACG 
0241 CGGCTGCAGG CCACACTGTA CTGCTGGATG AACTTCCAGA AGTTTCCGTT TGATGAGCAG 
0301 AAGTGTAAGA CCACATTGGA AAGTTGGATG TACAACACCA CGCTGGTGCA ACTCCACTGG 
0361 GAGACCGATA ACCCAGTGAG TTTCGACAAG CAACTTCAGC TGACGGAATA CAACCTGATT 
0421 GGGTCGCTGT ACAACGAATC CATCCGAGTG TCCAACGAAT CCTACATGTC CCATGGCTCC 
0481 TTGGAGGGCA ACTACAGCAT  
 in silico PCR Fragment
0001 AGTGACCTGC AGTTTACGGT GCAGGGTCTG CTGCAGTTGC GATACCTGGA CCCGCGCCTG 
0061 GCCTTCTCCA GCTATCTGCC TAACCGAAGG CAGCCCATAA TGGGGGAGTC GGAACTGAAG 
0121 AAGATGCTCT GGGTGCCACA TATATTCCTG ACCAACGAAC AGGCCTCCAC TGTCCTGGGC 
0181 ACCAGCGCCA AGGACGAGCT GACCAGCATT TATCCGAATG GCACAGTTCT TACATCCACG 
0241 CGGCTGCAGG CCACACTGTA CTGCTGGATG AACTTCCAGA AGTTTCCGTT TGATGAGCAG 
0301 AAGTGTAAGA CCACATTGGA AAGTTGGATG TACAACACCA CGCTGGTGCA ACTCCACTGG 
0361 GAGACCGATA ACCCAGTGAG TTTCGACAAG CAACTTCAGC TGACGGAATA CAACCTAATT 
0421 GGGTCGCTGT ACAACGAATC CATCCGAGTG TCCAACGAAT CCTACATGTC CCATGGCTCC 
0481 TTGGAGGGCA ACTACAGCAT  
 Assemble Data

11340R-3.IR_full       1   AGTGACCTGCAGTTTACGGTGCAGGGTCTGCTGCAGTTGCGATACTTGGACCCGCGCCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
11340R-3.in silico     1   AGTGACCTGCAGTTTACGGTGCAGGGTCTGCTGCAGTTGCGATACCTGGACCCGCGCCTG 60


11340R-3.IR_full       61  GCCTTCTCCAGCTATCTGCCCAACCGAAGGCAGCCCATAATGGGGGAGTCGGAACTGAAG 120
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
11340R-3.in silico     61  GCCTTCTCCAGCTATCTGCCTAACCGAAGGCAGCCCATAATGGGGGAGTCGGAACTGAAG 120


11340R-3.IR_full       121 AAGATGCTCTGGGTGCCACATATATTCCTGACCAACGAACAGGCCTCCACTGTCCTGGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11340R-3.in silico     121 AAGATGCTCTGGGTGCCACATATATTCCTGACCAACGAACAGGCCTCCACTGTCCTGGGC 180


11340R-3.IR_full       181 ACCAGCGCCAAGGACGAGCTGACCAGCATTTATCCGAATGGCACAGTTCTGACATCCACG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
11340R-3.in silico     181 ACCAGCGCCAAGGACGAGCTGACCAGCATTTATCCGAATGGCACAGTTCTTACATCCACG 240


11340R-3.IR_full       241 CGGCTGCAGGCCACACTGTACTGCTGGATGAACTTCCAGAAGTTTCCGTTTGATGAGCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11340R-3.in silico     241 CGGCTGCAGGCCACACTGTACTGCTGGATGAACTTCCAGAAGTTTCCGTTTGATGAGCAG 300


11340R-3.IR_full       301 AAGTGTAAGACCACATTGGAAAGTTGGATGTACAACACCACGCTGGTGCAACTCCACTGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11340R-3.in silico     301 AAGTGTAAGACCACATTGGAAAGTTGGATGTACAACACCACGCTGGTGCAACTCCACTGG 360


11340R-3.IR_full       361 GAGACCGATAACCCAGTGAGTTTCGACAAGCAACTTCAGCTGACGGAATACAACCTGATT 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
11340R-3.in silico     361 GAGACCGATAACCCAGTGAGTTTCGACAAGCAACTTCAGCTGACGGAATACAACCTAATT 420


11340R-3.IR_full       421 GGGTCGCTGTACAACGAATCCATCCGAGTGTCCAACGAATCCTACATGTCCCATGGCTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11340R-3.in silico     421 GGGTCGCTGTACAACGAATCCATCCGAGTGTCCAACGAATCCTACATGTCCCATGGCTCC 480


11340R-3.IR_full       481 TTGGAGGGCAACTACAGCAT 500
                           ||||||||||||||||||||
11340R-3.in silico     481 TTGGAGGGCAACTACAGCAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143604.1  CG11340-RA (CG11340), mRNA 
0   13  13  24  NM_140727.1  CG7589-RA (CG7589), mRNA 
0   NM_167506.1  CG18734-RA, transcript variant A (Fur2), mRNA 
0   NM_078644.2  CG18734-RD, transcript variant D (Fur2), mRNA 
0   NM_206763.1  CG18734-RG, transcript variant G (Fur2), mRNA 
0   NM_167508.1  CG18734-RC, transcript variant C (Fur2), mRNA 
0   NM_167510.1  CG18734-RF, transcript variant F (Fur2), mRNA 
0   NM_167507.1  CG18734-RB, transcript variant B (Fur2), mRNA 
0   NM_167509.1  CG18734-RE, transcript variant E (Fur2), mRNA 
0   NM_140254.2  CG14130-RA (CG14130), mRNA 
0   21  NM_131966.1  CG6927-RA (CG6927), mRNA 
0   NM_142292.1  CG14897-RB, transcript variant B (CG14897), mRNA 
0   NM_169720.1  CG14897-RA, transcript variant A (CG14897), mRNA 
0   NM_140054.2  CG3743-RA, transcript variant A (MTF-1), mRNA 
0   NM_168343.1  CG3743-RB, transcript variant B (MTF-1), mRNA 
0   NM_132127.2  CG4542-RA (CG4542), mRNA 
0   NM_205908.1  CG33113-RG, transcript variant G (Rtnl1), mRNA 
0   NM_135787.2  CG9414-RA (Rep4), mRNA 
0   NM_137831.2  CG4752-RA (CG4752), mRNA 
0   NM_175972.1  CG33113-RD, transcript variant D (Rtnl1), mRNA 
0   NM_078711.2  CG1424-RA (mst), mRNA 
0   NM_143182.2  CG5913-RA (CG5913), mRNA 
0   NM_167911.1  CG2086-RB, transcript variant B (drpr), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_167948.1  CG32306-RA, transcript variant A (CG32306), mRNA 
0   NM_167949.1  CG32306-RC, transcript variant C (CG32306), mRNA 
0   NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.