National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11335R-3 
 Symbol lox  Full Name lysyl oxidase-like 
 CG No CG11335  Old CG No CG11335 
 Synonyms DmLOXL-1, Dmloxl-1, dmlox-1, CG11335, lox, Lox 
 Accession No (Link to NCBI) NM_079868.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kim SN, Jeibmann A, Halama K, Witte HT, Wälte M, Matzat T, Schillers H, Faber C, Senner V, Paulus W, Klämbt C.
ECM stiffness regulates glial migration in Drosophila and mammalian glioma models.
Development (2014) 141(16) 3233-42 [ PubMed ID = 25063458 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCAACCTCAACGTGCAGAA 
 Primer Seq. 3'
aatctagaggtaccAAGCGTCGGCGGAAACACAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCAACCTC AACGTGCAGA ACAACTATAG AAACATGATG GTCCGACTGG CCACTAACAA 
0061 GGCAGCGCTC GCCGGTATTC AAGTCCTCCG CGAGGGACGC GTGGAGGTGA GCTTTGACTT 
0121 TGGCGCCTCA TGGGGTACGA TCTGCAGCAC TTCGTGGAGC ATGCGGGAGG CAAATGTGGT 
0181 GTGCCGACAG CTAGGATTGG GCTACGCTTC CAAGGCAAGC CAGGGAACGG AGCACGGGGA 
0241 TAGCCGGAAG TATCCCTGGG GCATGGTGGG CACTCTGTGC AGNGGGAACC GAGCGTCGCC 
0301 TAGCCGACTG CATCCGGGAG TCCCACTACC CGAACCTCTG CAATTCCAGA AACCATAATG 
0361 TCAGCATTGC GGCCTGTGTT AGCCATTCGG CTGACCTGGA GATCGGACTG GCTGGACATC 
0421 GAGAGAACCG CCCGCCTGGA GGCCGTGCCC ATGTCGCGGC TCACATGCGC CATGGAAGAG 
0481 CACTGTGTTT CCGCCGACGC TT 
 in silico PCR Fragment
0001 GGCCAACCTC AACGTGCAGA ACAACTATAG AAACATGATG GTCCGACTGG CCACTAACAA 
0061 GGCAGCGCTC GCCGGTATTC AAGTCCTCCG CGAGGGACGC GTGGAGGTGA GCTTTGACTT 
0121 TGGCGCCTCA TGGGGTACGA TCTGCAGCAC TTCGTGGAGC ATGCGGGAGG CAAATGTGGT 
0181 GTGCCGACAG CTAGGATTGG GCTACGCTTC CAAGGCAAGC CAGGGAACGG AGCACGGGGA 
0241 TAGCCGGAAG TATCCCTGGG GCATGGTGGG CACTCTGTGC AG-GGGAACC GAGCGTCGCC 
0301 TAGCCGACTG CATCCGGGAG TCCCACTACC CGAACCTCTG CAATGCCAGA AACCATAATG 
0361 TCAGCATTGC GGCCTGTGTT AGCCATTCGG CTGACCTGGA GATCGGACTG G-TGGACATC 
0421 GAGAGAACCG CCCGCCTGGA GGCCGTGCCC ATGTCGCGGC TCACATGCGC CATGGAAGAG 
0481 CACTGTGTTT CCGCCGACGC TT 
 Assemble Data

11335R-3.IR_full       1   GGCCAACCTCAACGTGCAGAACAACTATAGAAACATGATGGTCCGACTGGCCACTAACAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11335R-3.in silico     1   GGCCAACCTCAACGTGCAGAACAACTATAGAAACATGATGGTCCGACTGGCCACTAACAA 60


11335R-3.IR_full       61  GGCAGCGCTCGCCGGTATTCAAGTCCTCCGCGAGGGACGCGTGGAGGTGAGCTTTGACTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11335R-3.in silico     61  GGCAGCGCTCGCCGGTATTCAAGTCCTCCGCGAGGGACGCGTGGAGGTGAGCTTTGACTT 120


11335R-3.IR_full       121 TGGCGCCTCATGGGGTACGATCTGCAGCACTTCGTGGAGCATGCGGGAGGCAAATGTGGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11335R-3.in silico     121 TGGCGCCTCATGGGGTACGATCTGCAGCACTTCGTGGAGCATGCGGGAGGCAAATGTGGT 180


11335R-3.IR_full       181 GTGCCGACAGCTAGGATTGGGCTACGCTTCCAAGGCAAGCCAGGGAACGGAGCACGGGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11335R-3.in silico     181 GTGCCGACAGCTAGGATTGGGCTACGCTTCCAAGGCAAGCCAGGGAACGGAGCACGGGGA 240


11335R-3.IR_full       241 TAGCCGGAAGTATCCCTGGGGCATGGTGGGCACTCTGTGCAGNGGGAACCGAGCGTCGCC 300
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
11335R-3.in silico     241 TAGCCGGAAGTATCCCTGGGGCATGGTGGGCACTCTGTGCAG-GGGAACCGAGCGTCGCC 300


11335R-3.IR_full       301 TAGCCGACTGCATCCGGGAGTCCCACTACCCGAACCTCTGCAATTCCAGAAACCATAATG 360
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
11335R-3.in silico     301 TAGCCGACTGCATCCGGGAGTCCCACTACCCGAACCTCTGCAATGCCAGAAACCATAATG 360


11335R-3.IR_full       361 TCAGCATTGCGGCCTGTGTTAGCCATTCGGCTGACCTGGAGATCGGACTGGCTGGACATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
11335R-3.in silico     361 TCAGCATTGCGGCCTGTGTTAGCCATTCGGCTGACCTGGAGATCGGACTGG-TGGACATC 420


11335R-3.IR_full       421 GAGAGAACCGCCCGCCTGGAGGCCGTGCCCATGTCGCGGCTCACATGCGCCATGGAAGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11335R-3.in silico     421 GAGAGAACCGCCCGCCTGGAGGCCGTGCCCATGTCGCGGCTCACATGCGCCATGGAAGAG 480


11335R-3.IR_full       481 CACTGTGTTTCCGCCGACGCTT 502
                           ||||||||||||||||||||||
11335R-3.in silico     481 CACTGTGTTTCCGCCGACGCTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079868.2  CG11335-RA (lox), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_136888.2  CG12367-RA (CG12367), mRNA 
0   14  24  NM_079082.3  CG4402-RA (lox2), mRNA 
0   NM_137163.3  CG10255-RA (Lap1), mRNA 
0   NM_142837.2  CG17141-RA (CG17141), mRNA 
0   NM_153772.1  CG13867-RA (MED8), mRNA 
0   NM_170348.1  CG31055-RB, transcript variant B (CG31055), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 
0   NM_170346.1  CG31055-RA, transcript variant A (CG31055), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_169569.1  CG31533-RA (CG31533), mRNA 
0   NM_169309.3  CG8478-RA, transcript variant A (CG8478), mRNA 
0   NM_141684.3  CG8478-RB, transcript variant B (CG8478), mRNA 
0   NM_079063.2  CG10794-RA (DptB), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_139540.1  CG14960-RA (CG14960), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   NM_057992.2  CG5562-RA (gbb), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.