National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11274R-1 
 Symbol SRm160  Full Name SRm160 
 CG No CG11274  Old CG No CG11274 
 Synonyms CG11274, SRm160 
 Accession No (Link to NCBI) NM_140370.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Fan YJ, Gittis AH, Juge F, Qiu C, Xu YZ, Rabinow L.
Multifunctional RNA processing protein SRm160 induces apoptosis and regulates eye and genital development in Drosophila.
Genetics (2014) 197(4) 1251-65 [ PubMed ID = 24907259 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGTTCACGGGCACCAATCA 
 Primer Seq. 3'
aatctagaggtaccACTTGGATTTGGAGCGGTCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGTTCACG GGCACCAATC AGCAGCAGGA CACGCGGTTC AGCGACAAGG AGAAGAAGTT 
0061 GATGAAGCAA ATGAAGTNTC GGCGATTGCC TGAACAAGAG GGTGGATATG TCGAAAGTCA 
0121 AGCTGGACGT ACTGCGTCCG TGGATCAGCA AGAAGATCAC CGACATCCTG CACATCGANG 
0181 GACGACGTGG TCGTCGAGNT TTGTCTACAA TCAGCTGGAG GAGGAGAAGT ATCCGTGCCC 
0241 CAAGAAAATG CAGATCAATA TGACGGGCTT CTTGAACGGC CGAAATGCCC GCCAGTTTAT 
0301 GGGTGAACTT TGGGCCCTGC TGCTTTCGGC ACAGGAAAGC GATTCGGGTA TACCAGCGGA 
0361 GTTTATACAG CAGAAAAAGG ACGAGATACT CAAACGGGAG GAGGAACAGC GGCAGCGGGA 
0421 TCGATCGAGA TCCCGTTCGC GTTCCCGCTC CCAACGAGAC AGTTCTAGGC GAGATCGGCA 
0481 GCGTGACCGC TCCAAATCCA AGT 
 in silico PCR Fragment
0001 GATGTTCACG GGCACCAATC AGCAGCAGGA CACGCGGTTC AGCGACAAGG AGAAGAAGCT 
0061 GATGAAGCAA ATGAAGT-TC GGCGATTGCC TGAACAAGAG GGTGGATATG TCGAAAGTCA 
0121 AGCTGGACGT ACTGCGTCCG TGGATCAGCA AGAAGATCAC CGACATCCTG CACATCGA-G 
0181 GACGACGTGG TCGTCGAG-T TTGTCTACAA TCAGCTGGAG GAGGAGAAGT ATCCGTGCCC 
0241 CAAGAAAATG CAGATCAATA TGACGGGCTT CTTGAACGGC CGAAATGCCC GCCAGTTTAT 
0301 GGGTGAACTT TGGGCCCTGC TGCTTTCGGC ACAGGAAAGC GATTCGGGTA TACCAGCGGA 
0361 GTTTATACAG CAGAAAAAGG ACGAGATACT CAAACGGGAG GAGGAACAGC GGCAGCGGGA 
0421 TCGATCGAGA TCCCGTTCGC GTTCCCGCTC CCAACGAGAC AGTTCTAGGC GAGATCGGCA 
0481 GCGTGACCGC TCCAAATCCA AGT 
 Assemble Data

11274R-1.IR_full       1   GATGTTCACGGGCACCAATCAGCAGCAGGACACGCGGTTCAGCGACAAGGAGAAGAAGTT 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11274R-1.in silico     1   GATGTTCACGGGCACCAATCAGCAGCAGGACACGCGGTTCAGCGACAAGGAGAAGAAGCT 60


11274R-1.IR_full       61  GATGAAGCAAATGAAGTNTCGGCGATTGCCTGAACAAGAGGGTGGATATGTCGAAAGTCA 120
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     61  GATGAAGCAAATGAAGT-TCGGCGATTGCCTGAACAAGAGGGTGGATATGTCGAAAGTCA 120


11274R-1.IR_full       121 AGCTGGACGTACTGCGTCCGTGGATCAGCAAGAAGATCACCGACATCCTGCACATCGANG 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11274R-1.in silico     121 AGCTGGACGTACTGCGTCCGTGGATCAGCAAGAAGATCACCGACATCCTGCACATCGA-G 180


11274R-1.IR_full       181 GACGACGTGGTCGTCGAGNTTTGTCTACAATCAGCTGGAGGAGGAGAAGTATCCGTGCCC 240
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     181 GACGACGTGGTCGTCGAG-TTTGTCTACAATCAGCTGGAGGAGGAGAAGTATCCGTGCCC 240


11274R-1.IR_full       241 CAAGAAAATGCAGATCAATATGACGGGCTTCTTGAACGGCCGAAATGCCCGCCAGTTTAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     241 CAAGAAAATGCAGATCAATATGACGGGCTTCTTGAACGGCCGAAATGCCCGCCAGTTTAT 300


11274R-1.IR_full       301 GGGTGAACTTTGGGCCCTGCTGCTTTCGGCACAGGAAAGCGATTCGGGTATACCAGCGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     301 GGGTGAACTTTGGGCCCTGCTGCTTTCGGCACAGGAAAGCGATTCGGGTATACCAGCGGA 360


11274R-1.IR_full       361 GTTTATACAGCAGAAAAAGGACGAGATACTCAAACGGGAGGAGGAACAGCGGCAGCGGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     361 GTTTATACAGCAGAAAAAGGACGAGATACTCAAACGGGAGGAGGAACAGCGGCAGCGGGA 420


11274R-1.IR_full       421 TCGATCGAGATCCCGTTCGCGTTCCCGCTCCCAACGAGACAGTTCTAGGCGAGATCGGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11274R-1.in silico     421 TCGATCGAGATCCCGTTCGCGTTCCCGCTCCCAACGAGACAGTTCTAGGCGAGATCGGCA 480


11274R-1.IR_full       481 GCGTGACCGCTCCAAATCCAAGT 503
                           |||||||||||||||||||||||
11274R-1.in silico     481 GCGTGACCGCTCCAAATCCAAGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_140370.1  CG11274-RA (SRm160), mRNA 
0.2   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
0.2   NM_142882.1  CG17083-RA (CG17083), mRNA 
0.2   NM_135685.2  CG6686-RB, transcript variant B (CG6686), mRNA 
0.2   NM_164977.1  CG6686-RA, transcript variant A (CG6686), mRNA 
0   NM_057576.3  CG6407-RA (Wnt5), mRNA 
0   10  NM_139949.2  CG7185-RA (CG7185), mRNA 
0   17  NM_164887.1  CG31714-RA (CG31714), mRNA 
0   10  32  NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_141408.3  CG1137-RA (CG1137), mRNA 
0   NM_170388.1  CG11876-RC, transcript variant C (CG11876), mRNA 
0   NM_170387.1  CG11876-RB, transcript variant B (CG11876), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   16  NM_206773.1  CG32556-RB, transcript variant B (CG32556), mRNA 
0   14  NM_167574.1  CG32556-RA, transcript variant A (CG32556), mRNA 
0   NM_139874.1  CG7548-RA (CG7548), mRNA 
0   14  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_058105.4  CG7697-RA (CstF-64), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   NM_001014484.1  CG15279-RC, transcript variant C (CG15279), mRNA 
0   NM_140499.2  CG6876-RA (CG6876), mRNA 
0   NM_135882.2  CG15279-RA, transcript variant A (CG15279), mRNA 
0   NM_165093.1  CG15279-RB, transcript variant B (CG15279), mRNA 
0   NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
0   NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
0   NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
0   NM_136854.1  CG13194-RA (pyr), mRNA 
0   NM_167916.2  CG32315-RA (dlt), mRNA 
0   36  NM_133111.1  CG7358-RA (CG7358), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.