National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11266R-3 
 Symbol CG11266  Full Name CG11266 
 CG No CG11266  Old CG No CG11266 
 Synonyms CC1.3, CAPER, HCC1, cg11266, CG11266 
 Accession No (Link to NCBI) NM_164730.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Olesnicky EC, Bono JM, Bell L, Schachtner LT, Lybecker MC.
The RNA-binding protein caper is required for sensory neuron development in Drosophila melanogaster.
Dev Dyn (2017) 246(8) 610-624 [ PubMed ID = 28543982 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGACTTTGATGTGGAGGCG 
 Primer Seq. 3'
aatctagaggtaccGAGCGATCCACTTGCAACGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGGACTTTG ATGTGGAGGC GATGCTCGAG GCGCCGTACA TGAAAAACAA TGTCAGTGCG 
0061 GGCAGCGGTG GAAGTGGTGN GACGCAAGCG CAGCGGCAGC AGTCCAGGCG GCGGCGGTGG 
0121 ACACGATGAC GACTACGCCG AGAATGGTCC GCGGAACGGC AGCGGCGGCG GAAGCTCACA 
0181 CAAAAAGCAA AGCAAACGAT CCCGGAGTAG AAGCGGCTCG CGTGATGGCA AATCTCGACG 
0241 AGATCGCGGC AATGAACGCA GCAGTCATCG TGACAAGGAT AAGGAGCGCG ATCGTAACCG 
0301 CGACGGCGGC GACCGAGATC GACACCGCAG GGAAGGTGGC GATCGAGATC GGGAGCGGGA 
0361 ACGTGaGCGC GAACGCGACA GATCTCGTCG GAGTCGTTCG CGTGATGAGC GCGGTGGAGG 
0421 TGGtNGCTAC GGCGATCGTG ACAAGGAtNG CCGCTCGCGA GATCGACGCG GCGGCAGCAA 
0481 GTCGTTGCAA GTGGATCGCT C 
 in silico PCR Fragment
0001 GAGGACTTTG ATGTGGAGGC GATGCTCGAG GCGCCGTACA TGAAAAACAA TGTCAGTGCG 
0061 GGCAGCGGTG GAAGTGGTG- GACGCAAGCG CAGCGGCAGC AGTCCAGGCG GCGGCGGTGG 
0121 ACACGATGAC GACTACGCCG AGAATGGTCC GCGGAACGGC AGCGGCGGCG GAAGCTCACA 
0181 CAAAAAGCAA AGCAAACGAT CCCGGAGTAG AAGCGGCTCG CGTGATGGCA AATCTCGACG 
0241 AGATCGCGGC AATGAACGCA GCAGTCATCG GGACAAGGAT AAGGAGCGCG ATCGTAACCG 
0301 CGACGGCGGC GACCGAGATC GACACCGCAG GGAAGGTGGC GATCGAGATC GGGAGCGGGA 
0361 ACGTGAGCGC GAACGCGACA GATCTCGTCG GAGTCGTTCG CGTGATGAGC GCGGTGGAGG 
0421 TGGTCGCTAC GGCGATCGTG ACAAGGATCG CCGCTCGCGA GATCGACGCG GCGGCAGCAA 
0481 GTCGTTGCAA GTGGATCGCT C 
 Assemble Data

11266R-3.IR_full       1   GAGGACTTTGATGTGGAGGCGATGCTCGAGGCGCCGTACATGAAAAACAATGTCAGTGCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     1   GAGGACTTTGATGTGGAGGCGATGCTCGAGGCGCCGTACATGAAAAACAATGTCAGTGCG 60


11266R-3.IR_full       61  GGCAGCGGTGGAAGTGGTGNGACGCAAGCGCAGCGGCAGCAGTCCAGGCGGCGGCGGTGG 120
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     61  GGCAGCGGTGGAAGTGGTG-GACGCAAGCGCAGCGGCAGCAGTCCAGGCGGCGGCGGTGG 120


11266R-3.IR_full       121 ACACGATGACGACTACGCCGAGAATGGTCCGCGGAACGGCAGCGGCGGCGGAAGCTCACA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     121 ACACGATGACGACTACGCCGAGAATGGTCCGCGGAACGGCAGCGGCGGCGGAAGCTCACA 180


11266R-3.IR_full       181 CAAAAAGCAAAGCAAACGATCCCGGAGTAGAAGCGGCTCGCGTGATGGCAAATCTCGACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     181 CAAAAAGCAAAGCAAACGATCCCGGAGTAGAAGCGGCTCGCGTGATGGCAAATCTCGACG 240


11266R-3.IR_full       241 AGATCGCGGCAATGAACGCAGCAGTCATCGTGACAAGGATAAGGAGCGCGATCGTAACCG 300
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
11266R-3.in silico     241 AGATCGCGGCAATGAACGCAGCAGTCATCGGGACAAGGATAAGGAGCGCGATCGTAACCG 300


11266R-3.IR_full       301 CGACGGCGGCGACCGAGATCGACACCGCAGGGAAGGTGGCGATCGAGATCGGGAGCGGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     301 CGACGGCGGCGACCGAGATCGACACCGCAGGGAAGGTGGCGATCGAGATCGGGAGCGGGA 360


11266R-3.IR_full       361 ACGTGAGCGCGAACGCGACAGATCTCGTCGGAGTCGTTCGCGTGATGAGCGCGGTGGAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11266R-3.in silico     361 ACGTGAGCGCGAACGCGACAGATCTCGTCGGAGTCGTTCGCGTGATGAGCGCGGTGGAGG 420


11266R-3.IR_full       421 TGGTNGCTACGGCGATCGTGACAAGGATNGCCGCTCGCGAGATCGACGCGGCGGCAGCAA 480
                           |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||
11266R-3.in silico     421 TGGTCGCTACGGCGATCGTGACAAGGATCGCCGCTCGCGAGATCGACGCGGCGGCAGCAA 480


11266R-3.IR_full       481 GTCGTTGCAAGTGGATCGCTC 501
                           |||||||||||||||||||||
11266R-3.in silico     481 GTCGTTGCAAGTGGATCGCTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164730.1  CG11266-RA, transcript variant A (CG11266), mRNA 
100   482  NM_135251.2  CG11266-RB, transcript variant B (CG11266), mRNA 
96.47   465  13  NM_164733.1  CG11266-RD, transcript variant D (CG11266), mRNA 
96.47   465  13  NM_164732.1  CG11266-RC, transcript variant C (CG11266), mRNA 
96.47   465  11  NM_164735.1  CG11266-RG, transcript variant G (CG11266), mRNA 
96.47   465  10  NM_164734.1  CG11266-RF, transcript variant F (CG11266), mRNA 
90.04   434  NM_164731.1  CG11266-RE, transcript variant E (CG11266), mRNA 
0.41   10  17  NM_137995.2  CG18426-RA (ytr), mRNA 
0.2   17  32  NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0.2   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0.2   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0.2   NM_132543.1  CG10362-RA (CG10362), mRNA 
0   12  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   12  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   34  NM_176491.1  CG10851-RB, transcript variant B (B52), mRNA 
0   34  NM_001014619.1  CG10851-RH, transcript variant H (B52), mRNA 
0   34  NM_176493.2  CG10851-RF, transcript variant F (B52), mRNA 
0   34  NM_176492.2  CG10851-RD, transcript variant D (B52), mRNA 
0   34  NM_176488.1  CG10851-RA, transcript variant A (B52), mRNA 
0   34  NM_176494.2  CG10851-RG, transcript variant G (B52), mRNA 
0   34  NM_176490.1  CG10851-RE, transcript variant E (B52), mRNA 
0   34  NM_176489.1  CG10851-RC, transcript variant C (B52), mRNA 
0   53  NM_132278.2  CG12075-RA, transcript variant A (CG12075), mRNA 
0   53  NM_206663.1  CG12075-RB, transcript variant B (CG12075), mRNA 
0   NM_137848.2  CG3732-RA (CG3732), mRNA 
0   NM_141935.2  CG5663-RA (Dip-C), mRNA 
0   22  32  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   12  35  NM_164716.1  CG31632-RA (CG31632), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   18  80  NM_133111.1  CG7358-RA (CG7358), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.