National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11263R-2 
 Symbol CG11263  Full Name CG11263 
 CG No CG11263  Old CG No CG11263 
 Synonyms CG11263 
 Accession No (Link to NCBI) NM_140361.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yang Z, Chen KM, Pandey RR, Homolka D, Reuter M, Janeiro BK, Sachidanandam R, Fauvarque MO, McCarthy AA, Pillai RS.
PIWI Slicing and EXD1 Drive Biogenesis of Nuclear piRNAs from Cytosolic Targets of the Mouse piRNA Pathway.
Mol. Cell (2016) 61(1) 138-52 [ PubMed ID = 26669262 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGGAGAAGCAACTAGATCG 
 Primer Seq. 3'
aatctagaggtaccCCAACTTGGCCAAGTATCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGGAGAAG CAACTAGATC GAATTGTTTT GATATACCAG GTGGATACCA CATACCACAG 
0061 TGCACTAAAG GACATAAAGG ATCAGAAGAT CATATCGCTG CTGGTGGAGC CCAGTTTTTA 
0121 CGGACGACAT CACCCCACGT CTATTTTGGT GGTAGCCACG TGCAATGGAA CGTACATTTT 
0181 CGACATCAAG GCCCTTGGCT TGATATTTCT GGAACTGGCC AAGATTCTGG AGGCGGATCA 
0241 GCCGCGCNAA GGTAATCCAC TACAGCCACC GGATCGCCGA TCATCTGTTG CATANGGCAA 
0301 CGCATCTCGT TGGGAGGAAT ATTTGATACC TTTGTGGCTC TATGCCTGAG CAGCAACACA 
0361 AGAATTCCGT ACACCTTGCC AGAGGCTATA TCTCTCGTCT TCGGACTACC CATGGAGAAG 
0421 GTGACTGGAG GCTGTGAGTC GCAGCGTAAC TTCACTGCTC GTCCACTGAC CCACAGTCAA 
0481 ATGAGATACT TGGCCAAGTT GG 
 in silico PCR Fragment
0001 CCTGGAGAAG CAACTAGATC GAATTGTTTT GATATACCAG GTGGATACCA CATACCACAG 
0061 TGCACTAAAG GACATAAAGG ATCAGAAGAT CATATCGCTG CTGGTGGAGC CCAGTTTTTA 
0121 CGGACGACAT CACCCCACGT CTATTTTGGT GGTAGCCACG TGCAATGGAA CGTACATTTT 
0181 CGACATCAAG GCCCTTGGCT TGATATTTCT GGAACTGGCC AAGATTCTGG AGGCGGATCA 
0241 GCCGCGC-AA GGTAATCCAC TACAGCCACC GGATCGCCGA TCATCTGTTG CATA-GGCAA 
0301 CGCATCTCGT TGGGAGGAAT ATTTGATACC TTTGTGGCTG TATGCCTGAG CAGCAACACA 
0361 AGAATTCCGT ACACCTTGCC AGAGGCTATA TCTCTCGTCT TCGGACTACC CATGGAGAAG 
0421 GTGACTGGAG GCTGTGAGTC GCAGCGTAAC TTCACTGCTC GTCCACTGAC CCACAGTCAA 
0481 ATGAGATACT TGGCCAAGTT GG 
 Assemble Data

11263R-2.IR_full       1   CCTGGAGAAGCAACTAGATCGAATTGTTTTGATATACCAGGTGGATACCACATACCACAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     1   CCTGGAGAAGCAACTAGATCGAATTGTTTTGATATACCAGGTGGATACCACATACCACAG 60


11263R-2.IR_full       61  TGCACTAAAGGACATAAAGGATCAGAAGATCATATCGCTGCTGGTGGAGCCCAGTTTTTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     61  TGCACTAAAGGACATAAAGGATCAGAAGATCATATCGCTGCTGGTGGAGCCCAGTTTTTA 120


11263R-2.IR_full       121 CGGACGACATCACCCCACGTCTATTTTGGTGGTAGCCACGTGCAATGGAACGTACATTTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     121 CGGACGACATCACCCCACGTCTATTTTGGTGGTAGCCACGTGCAATGGAACGTACATTTT 180


11263R-2.IR_full       181 CGACATCAAGGCCCTTGGCTTGATATTTCTGGAACTGGCCAAGATTCTGGAGGCGGATCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     181 CGACATCAAGGCCCTTGGCTTGATATTTCTGGAACTGGCCAAGATTCTGGAGGCGGATCA 240


11263R-2.IR_full       241 GCCGCGCNAAGGTAATCCACTACAGCCACCGGATCGCCGATCATCTGTTGCATANGGCAA 300
                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
11263R-2.in silico     241 GCCGCGC-AAGGTAATCCACTACAGCCACCGGATCGCCGATCATCTGTTGCATA-GGCAA 300


11263R-2.IR_full       301 CGCATCTCGTTGGGAGGAATATTTGATACCTTTGTGGCTCTATGCCTGAGCAGCAACACA 360
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
11263R-2.in silico     301 CGCATCTCGTTGGGAGGAATATTTGATACCTTTGTGGCTGTATGCCTGAGCAGCAACACA 360


11263R-2.IR_full       361 AGAATTCCGTACACCTTGCCAGAGGCTATATCTCTCGTCTTCGGACTACCCATGGAGAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     361 AGAATTCCGTACACCTTGCCAGAGGCTATATCTCTCGTCTTCGGACTACCCATGGAGAAG 420


11263R-2.IR_full       421 GTGACTGGAGGCTGTGAGTCGCAGCGTAACTTCACTGCTCGTCCACTGACCCACAGTCAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11263R-2.in silico     421 GTGACTGGAGGCTGTGAGTCGCAGCGTAACTTCACTGCTCGTCCACTGACCCACAGTCAA 480


11263R-2.IR_full       481 ATGAGATACTTGGCCAAGTTGG 502
                           ||||||||||||||||||||||
11263R-2.in silico     481 ATGAGATACTTGGCCAAGTTGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140361.1  CG11263-RA (CG11263), mRNA 
0   NM_170036.1  CG31239-RA (CG31239), mRNA 
0   NM_142947.2  CG5933-RA (CG5933), mRNA 
0   NM_132760.3  CG9009-RA (CG9009), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_132616.1  CG15721-RA (CG15721), mRNA 
0   NM_139928.3  CG7999-RA (MED24), mRNA 
0   NM_136483.2  CG12822-RA, transcript variant A (CG12822), mRNA 
0   NM_206052.1  CG12822-RB, transcript variant B (CG12822), mRNA 
0   NM_140431.2  CG6451-RA (blue), mRNA 
0   NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   NM_080189.2  CG16880-RA (l(2)34Fa), mRNA 
0   NM_140447.1  CG9598-RA (CG9598), mRNA 
0   NM_144328.2  CG10570-RA (CG10570), mRNA 
0   NM_164377.1  CG3645-RB, transcript variant B (CG3645), mRNA 
0   NM_134663.2  CG3645-RA, transcript variant A (CG3645), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_057604.3  CG1825-RA (Map60), mRNA 
0   NM_206019.1  CG9270-RB, transcript variant B (CG9270), mRNA 
0   NM_136235.2  CG9270-RA, transcript variant A (CG9270), mRNA 
0   NM_142676.2  CG11622-RA (Rlip), mRNA 
0   NM_140439.2  CG5842-RA (nan), mRNA 
0   NM_166669.1  CG4527-RB, transcript variant B (slik), mRNA 
0   NM_206214.1  CG4527-RC, transcript variant C (slik), mRNA 
0   NM_206213.1  CG4527-RD, transcript variant D (slik), mRNA 
0   NM_136155.2  CG10628-RA (CG10628), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.