National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11173R-2 
 Symbol usnp  Full Name ubisnap 
 CG No CG11173  Old CG No CG11173 
 Synonyms SNAP-29, CG11173, Ubisnap, unnamed, usnp 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Takáts S, Nagy P, Varga Á, Pircs K, Kárpáti M, Varga K, Kovács AL, Hegedűs K, Juhász G.
Autophagosomal Syntaxin17-dependent lysosomal degradation maintains neuronal function in Drosophila.
J. Cell Biol. (2013) 201(4) 531-9 [ PubMed ID = 23671310 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCCAGTGCACGATCACTTC 
 Primer Seq. 3'
aatctagaggtaccCTATTGGCCTCCTGGGAGGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11173R-2.IR full       1   CAGCCAGTGCACGATCACTTCGATGACGTGGACAGATTCGAGGACGTGGACGACGACCTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11173R-2.in silico     1   CAGCCAGTGCACGATCACTTCGATGACGTGGACAGATTCGAGGACGTGGACGACGACCTA 60


11173R-2.IR full       61  TTCCTGCAGAACAAACGGACGGGAGCAGCCAAGCTTCCGCAGCAGAGGAGCACCAATCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11173R-2.in silico     61  TTCCTGCAGAACAAACGGACGGGAGCAGCCAAGCTTCCGCAGCAGAGGAGCACCAATCCC 120


11173R-2.IR full       121 TTCGAGATGGATGACGATGACGAAGAGGAGATAACCTCGTCGCCATCGGTGGNCGNACAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||
11173R-2.in silico     121 TTCGAGATGGATGACGATGACGAAGAGGAGATAACCTCGTCGCCATCAGTGGCCGCACAG 180


11173R-2.IR full       181 CGACTGGCCTATGCTGAGAAGCGAAGGGCCATTGAGCAGCGAACTCTGGACTCCACCAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
11173R-2.in silico     181 CGACTGGCCTATGCTGAGAAGCGAAGGGCCATTGAGCAGCGAACTCTGGACTCTACCAAC 240


11173R-2.IR full       241 AAAAGCTTGGGTCTGCTCTACGAAACCCAGGAGGTGGGTAAGGCGACGGCCGTGGAGCTN 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
11173R-2.in silico     241 AAAAGCTTGGGTCTGCTCTACGAAACCCAGGAGGTGGGTAAGGCGACGGCCGTGGAGCTG 300


11173R-2.IR full       301 GCCAAGCAGCGGGAGCAACTGGAGAAGACATCACATCAGTTGGACGAGATCAGCTCCACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11173R-2.in silico     301 GCCAAGCAGCGGGAGCAACTGGAGAAGACATCACATCAGTTGGACGAGATCAGCTCCACG 360


11173R-2.IR full       361 CTGCGCTTCAGCCAGCGCCATCTGACTGGTCTGAAGAGTGTCTTCGGCGGCCTCAAGAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
11173R-2.in silico     361 CTGCGCTTCAGCCAGCGCCATCTGACTGGTCTGAAGAGTGTCTTCGGCGGCCTCAAGAAC 420


11173R-2.IR full       421 TANCTCTCGGGCAACAGGGACCAACCACCCACCGCGACTGGTTN-CCCACGGGCAGTCAG 480
                           || || |||||||||||||||||||||||||||||||||||||  |||||||||||||||
11173R-2.in silico     421 TACCTTTCGGGCAACAGGGACCAACCACCCACCGCGACTGGTTCGCCCACGGGCAGTCAG 480


11173R-2.IR full       481 TNCTCCCAGGAGGCCAATAG 500
                           | ||||||||||||||||||
11173R-2.in silico     481 TCCTCCCAGGAGGCCAATAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.