National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11149R-2 
 Symbol CG11149  Full Name CG11149 
 CG No CG11149  Old CG No CG11149 
 Synonyms CG11149 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATATGTCCGTCTGTGGCCAGT 
 Primer Seq. 3'
aatctagaggtaccCATACCGAATGGCATCCAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11149R-2.IR full       1   ATATGTCCGTCTGTGNCCAGTGCTCATACTGTTCAATGTGGCACTCCTGCTGGTTTGGAG 60
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     1   ATATGTCCGTCTGTGGCCAGTGCTCATACTGTTCAATGTGGCACTCCTGCTGGTTTGGAG 60


11149R-2.IR full       61  GAACCTGCAGCAGGCCCAGAAACTGGCCGCATCTTCTAATACTGGTGGGCAAAAGTCGGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     61  GAACCTGCAGCAGGCCCAGAAACTGGCCGCATCTTCTAATACTGGTGGGCAAAAGTCGGT 120


11149R-2.IR full       121 AGGACTTTTGCTGTCCAACGAGTCGAATCCCTCACGTTTTTCTGCAAACTTCCATCTCAC 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11149R-2.in silico     121 AGGACTTTTGCTGTCCAACGAGTCGAATCCCTCACGTTTTTCTGCAAACTTCCATCTCGC 180


11149R-2.IR full       181 CAATGATCAGCATCCGAAAATAATCCGGCGAGAGGACTCCGCTCGCACCAAGGAATTGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     181 CAATGATCAGCATCCGAAAATAATCCGGCGAGAGGACTCCGCTCGCACCAAGGAATTGCG 240


11149R-2.IR full       241 ATCATTGCTCAAGTGCCGCGACCGATCGCTCCGTTTCGAGAGGCTTCAGCACGGAGAGTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     241 ATCATTGCTCAAGTGCCGCGACCGATCGCTCCGTTTCGAGAGGCTTCAGCACGGAGAGTT 300


11149R-2.IR full       301 CTGGCTGCTTCAGAATCTTGTCATGGGACGAAAGAGTCGGGAAGTCGGCTGTGCCGAGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     301 CTGGCTGCTTCAGAATCTTGTCATGGGACGAAAGAGTCGGGAAGTCGGCTGTGCCGAGTC 360


11149R-2.IR full       361 CGTGACGTATACCACCAACGGGGACTTTACGTTCTTCGATAATCTGGAAATGGTGGTATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     361 CGTGACGTATACCACCAACGGGGACTTTACGTTCTTCGATAATCTGGAAATGGTGGTATC 420


11149R-2.IR full       421 ACGTTGGCGTGCTCCAGTTAGTTTTGCCATCCACACTCCAGGTTATGATCTTAACACCAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11149R-2.in silico     421 ACGTTGGCGTGCTCCAGTTAGTTTTGCCATCCACACTCCAGGTTATGATCTTAACACCAC 480


11149R-2.IR full       481 ACTGGATGNCATTCGGTATG 500
                           |||||||| |||||||||||
11149R-2.in silico     481 ACTGGATGCCATTCGGTATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_135108.2  CG11149-RB, transcript variant B (CG11149), mRNA 
100  482  NM_164657.1  CG11149-RA, transcript variant A (CG11149), mRNA 
NM_168551.1  starvin CG32130-RA, transcript variant A (stv), mRNA 
NM_142075.1  CG14358-RA (CG14358), mRNA 
NM_140317.2  CG14122-RA (CG14122), mRNA 
NM_135958.3  trpgamma CG5996-RA, transcript variant A (trpgamma), mRNA 
NM_165169.3  trpgamma CG5996-RB, transcript variant B (trpgamma), mRNA 
NM_140809.2  Rad9 CG3945-RA (Rad9), mRNA 
NM_135745.1  CG5787-RA (CG5787), mRNA 
NM_136770.1  CG12342-RA, transcript variant A (CG12342), mRNA 
NM_165800.1  CG12342-RB, transcript variant B (CG12342), mRNA 
NM_079262.2  Gram-negative bacteria binding protein 3 CG5008-RA (GNBP3), mRNA 
NM_139562.1  CG14973-RA (CG14973), mRNA 
NM_057442.3  wing blister CG15288-RA, transcript variant A (wb), mRNA 
NM_165086.1  wing blister CG15288-RB, transcript variant B (wb), mRNA 
NM_142180.2  CG4285-RA (CG4285), mRNA 
NM_136660.1  CG1827-RA, transcript variant A (CG1827), mRNA 
NM_165684.1  CG1827-RB, transcript variant B (CG1827), mRNA 
NM_206253.1  Peroxidasin CG12002-RE, transcript variant E (Pxn), mRNA 
NM_206254.1  Peroxidasin CG12002-RD, transcript variant D (Pxn), mRNA 
NM_206255.1  Peroxidasin CG12002-RC, transcript variant C (Pxn), mRNA 
NM_079167.3  Peroxidasin CG12002-RA, transcript variant A (Pxn), mRNA 
NM_135329.1  CG12560-RA (CG12560), mRNA 
NM_132032.1  CG15769-RA (CG15769), mRNA 
NM_138268.1  CG12084-RA (CG12084), mRNA 
NM_167957.1  Peroxidasin CG12002-RB, transcript variant B (Pxn), mRNA 
NM_135795.1  CG9395-RA (CG9395), mRNA 
NM_164965.1  spalt-related CG4881-RB, transcript variant B (salr), mRNA 
NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
NM_078824.2  spalt-related CG4881-RA, transcript variant A (salr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.