National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11142R-1 
 Symbol obst-E  Full Name obstructor-E 
 CG No CG11142  Old CG No CG11142 
 Synonyms obst-E, CG11142 
 Accession No (Link to NCBI) NM_135113.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tajiri R, Ogawa N, Fujiwara H, Kojima T.
Mechanical Control of Whole Body Shape by a Single Cuticular Protein Obstructor-E in Drosophila melanogaster.
PLoS Genet. (2017) 13(1) e1006548 [ PubMed ID = 28076349 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTCTATTGTGCGTTGCCAT 
 Primer Seq. 3'
aatctagaggtaccTGTAGTCAGCCTCCTGCTCGC 
 Predicted Fragment Size
503 
 IR fragment full Seq
0001 TGCTCTATTG TGCGTTGCCA TGTTTGGCTC AATGGCTGCC GCCGCCGCCG GTGCATGCAA 
0061 GGAGGCGAAT GGAACTGCTC CCGTGCCCGG ATCCTGCGAT GCCTACATTG AGTGCAAGAA 
0121 CGGAGTGGCC GAGGAGAAGC TCTGCCCCGA CGGTCTGCTG TACAACGAAA AGTCCACGGG 
0181 TTACCCCTGC GGCTATCCGA TCGACGTGGA GTGCACCCAG GGCCAGGCCC CNCTGCAGGC 
0241 CGCTCAGCCA ACGGATGAGT GCCCCCACCA GTTCGGATAC TANCCGCATG NGCGATGCCA 
0301 GCCACTGTGG ACAGTTTATG AANCTGCGCC GCGGGCCGTG GCTTCGTGTT CGACTGCCCC 
0361 GAGGGTCTGG CCTGGAATCC GGCCACCTAC AAGTGCGATT GGCCCGATCA GGTGGAGGAC 
0421 TGTGACGCCG AGGCCTTCCT GGGCTTCCGC TGCCCAGCGC CGGCACCCAG ATCTGAGCTG 
0481 CTCGGCGAGC AGGAGGCTGA CTACA 
 in silico PCR Fragment
0001 TGCTCTATTG TGCGTTGCCA TGTTTGGCTC AATGGCTGCC GCCGCCGCCG GTGCATGCAA 
0061 GGAGGCGAAT GGAACTGCTC CCGTGTCCGG ATCCTGCGAT GCCTACATTG AGTGCAAGAA 
0121 CGGAGTGGCC GAGGAGAAGC TCTGCCCCGA CGGTCTGCTG TACAACGAAA AGTCCACGGG 
0181 TTACCCCTGC GGCTATCCGA TCGACGTGGA GTGCACCCAG GGCCAGGCCC GCCTGCAGGC 
0241 CGCTCAGCCA ACGGATGAGT GCCCCCACCA GTTCGGATAC TA-TCGCATG GGTGATGCCA 
0301 GCCATTGTGG ACAGTTCATG AA-CTGCGCC GCGGGCCGTG GCTTCGTGTT CGACTGCCCC 
0361 GAGGGTCTGG CCTGGAATCC GGCCACCTAC AAGTGCGATT GGCCCGATCA GGTGGAGGAC 
0421 TGTGACGCCG AGGCCTTCCT GGGCTTCCGC TGCCCAGCGC CGGCACCCAG ATCTGAGCTG 
0481 CTCGGCGAGC AGGAGGCTGA CTACA 
 Assemble Data

11142R-1.IR_full       1   TGCTCTATTGTGCGTTGCCATGTTTGGCTCAATGGCTGCCGCCGCCGCCGGTGCATGCAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11142R-1.in silico     1   TGCTCTATTGTGCGTTGCCATGTTTGGCTCAATGGCTGCCGCCGCCGCCGGTGCATGCAA 60


11142R-1.IR_full       61  GGAGGCGAATGGAACTGCTCCCGTGCCCGGATCCTGCGATGCCTACATTGAGTGCAAGAA 120
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
11142R-1.in silico     61  GGAGGCGAATGGAACTGCTCCCGTGTCCGGATCCTGCGATGCCTACATTGAGTGCAAGAA 120


11142R-1.IR_full       121 CGGAGTGGCCGAGGAGAAGCTCTGCCCCGACGGTCTGCTGTACAACGAAAAGTCCACGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11142R-1.in silico     121 CGGAGTGGCCGAGGAGAAGCTCTGCCCCGACGGTCTGCTGTACAACGAAAAGTCCACGGG 180


11142R-1.IR_full       181 TTACCCCTGCGGCTATCCGATCGACGTGGAGTGCACCCAGGGCCAGGCCCCNCTGCAGGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
11142R-1.in silico     181 TTACCCCTGCGGCTATCCGATCGACGTGGAGTGCACCCAGGGCCAGGCCCGCCTGCAGGC 240


11142R-1.IR_full       241 CGCTCAGCCAACGGATGAGTGCCCCCACCAGTTCGGATACTANCCGCATGNGCGATGCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||  |||||| | |||||||
11142R-1.in silico     241 CGCTCAGCCAACGGATGAGTGCCCCCACCAGTTCGGATACTA-TCGCATGGGTGATGCCA 300


11142R-1.IR_full       301 GCCACTGTGGACAGTTTATGAANCTGCGCCGCGGGCCGTGGCTTCGTGTTCGACTGCCCC 360
                           |||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||
11142R-1.in silico     301 GCCATTGTGGACAGTTCATGAA-CTGCGCCGCGGGCCGTGGCTTCGTGTTCGACTGCCCC 360


11142R-1.IR_full       361 GAGGGTCTGGCCTGGAATCCGGCCACCTACAAGTGCGATTGGCCCGATCAGGTGGAGGAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11142R-1.in silico     361 GAGGGTCTGGCCTGGAATCCGGCCACCTACAAGTGCGATTGGCCCGATCAGGTGGAGGAC 420


11142R-1.IR_full       421 TGTGACGCCGAGGCCTTCCTGGGCTTCCGCTGCCCAGCGCCGGCACCCAGATCTGAGCTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11142R-1.in silico     421 TGTGACGCCGAGGCCTTCCTGGGCTTCCGCTGCCCAGCGCCGGCACCCAGATCTGAGCTG 480


11142R-1.IR_full       481 CTCGGCGAGCAGGAGGCTGACTACA 505
                           |||||||||||||||||||||||||
11142R-1.in silico     481 CTCGGCGAGCAGGAGGCTGACTACA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   485  NM_135113.2  CG11142-RA, transcript variant A (CG11142), mRNA 
3.91   19  18  36  NM_164659.1  CG11142-RB, transcript variant B (CG11142), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 
0   NM_206270.1  CG10847-RA, transcript variant A (enc), mRNA 
0   NM_001014616.1  CG33512-RA (dpr4), mRNA 
0   NM_176579.1  CG33203-RC (CG33203), mRNA 
0   NM_135994.1  CG5043-RA (CG5043), mRNA 
0   12  NM_169853.1  CG3619-RB, transcript variant B (Dl), mRNA 
0   12  NM_057916.3  CG3619-RA, transcript variant A (Dl), mRNA 
0   14  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   14  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   13  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0   13  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0   12  NM_079469.2  CG10573-RA (ko), mRNA 
0   NM_142444.1  CG18599-RA (CG18599), mRNA 
0   10  NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_137255.2  CG15706-RA (CG15706), mRNA 
0   17  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   17  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   13  NM_169817.1  CG14307-RG, transcript variant G (fru), mRNA 
0   13  NM_169820.1  CG14307-RC, transcript variant C (fru), mRNA 
0   13  NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 
0   13  NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 
0   13  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   13  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   11  NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   11  NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   11  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.