National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11142R-1 
 Symbol obst-E  Full Name obstructor-E 
 CG No CG11142  Old CG No CG11142 
 Synonyms obst-E, CG11142 
 Accession No (Link to NCBI) NM_135113.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tajiri R, Ogawa N, Fujiwara H, Kojima T.
Mechanical Control of Whole Body Shape by a Single Cuticular Protein Obstructor-E in Drosophila melanogaster.
PLoS Genet. (2017) 13(1) e1006548 [ PubMed ID = 28076349 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCTCTATTGTGCGTTGCCATGTTTGGCTCAATGGCTGCCGCCGCCGCCGGTGCATGCAA 60

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     61  GGAGGCGAATGGAACTGCTCCCGTGTCCGGATCCTGCGATGCCTACATTGAGTGCAAGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGAGTGGCCGAGGAGAAGCTCTGCCCCGACGGTCTGCTGTACAACGAAAAGTCCACGGG 180

                           ||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||| silico     181 TTACCCCTGCGGCTATCCGATCGACGTGGAGTGCACCCAGGGCCAGGCCCGCCTGCAGGC 240

                           ||||||||||||||||||||||||||||||||||||||||||  |||||| | ||||||| silico     241 CGCTCAGCCAACGGATGAGTGCCCCCACCAGTTCGGATACTA-TCGCATGGGTGATGCCA 300

                           |||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| silico     301 GCCATTGTGGACAGTTCATGAA-CTGCGCCGCGGGCCGTGGCTTCGTGTTCGACTGCCCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGGGTCTGGCCTGGAATCCGGCCACCTACAAGTGCGATTGGCCCGATCAGGTGGAGGAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTGACGCCGAGGCCTTCCTGGGCTTCCGCTGCCCAGCGCCGGCACCCAGATCTGAGCTG 480

11142R-1.IR_full       481 CTCGGCGAGCAGGAGGCTGACTACA 505
                           ||||||||||||||||||||||||| silico     481 CTCGGCGAGCAGGAGGCTGACTACA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   485  NM_135113.2  CG11142-RA, transcript variant A (CG11142), mRNA 
3.91   19  18  36  NM_164659.1  CG11142-RB, transcript variant B (CG11142), mRNA 
0   NM_080026.2  CG10847-RB, transcript variant B (enc), mRNA 
0   NM_206270.1  CG10847-RA, transcript variant A (enc), mRNA 
0   NM_001014616.1  CG33512-RA (dpr4), mRNA 
0   NM_176579.1  CG33203-RC (CG33203), mRNA 
0   NM_135994.1  CG5043-RA (CG5043), mRNA 
0   12  NM_169853.1  CG3619-RB, transcript variant B (Dl), mRNA 
0   12  NM_057916.3  CG3619-RA, transcript variant A (Dl), mRNA 
0   14  NM_168739.2  CG32180-RC, transcript variant C (Eip74EF), mRNA 
0   14  NM_168740.2  CG32180-RA, transcript variant A (Eip74EF), mRNA 
0   13  NM_001014590.1  CG32180-RD, transcript variant D (Eip74EF), mRNA 
0   13  NM_168741.2  CG32180-RB, transcript variant B (Eip74EF), mRNA 
0   12  NM_079469.2  CG10573-RA (ko), mRNA 
0   NM_142444.1  CG18599-RA (CG18599), mRNA 
0   10  NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_137255.2  CG15706-RA (CG15706), mRNA 
0   17  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   17  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   13  NM_169817.1  CG14307-RG, transcript variant G (fru), mRNA 
0   13  NM_169820.1  CG14307-RC, transcript variant C (fru), mRNA 
0   13  NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 
0   13  NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 
0   13  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   13  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   11  NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   11  NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   11  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.