National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11133R-1 
 Symbol CG11133  Full Name CG11133 
 CG No CG11133  Old CG No CG11133 
 Synonyms CG11133 
 Accession No (Link to NCBI) NM_141173.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pale eye color 
 Map Viewer
 Reference
[Please submit your publication]
Yang Z, Chen KM, Pandey RR, Homolka D, Reuter M, Janeiro BK, Sachidanandam R, Fauvarque MO, McCarthy AA, Pillai RS.
PIWI Slicing and EXD1 Drive Biogenesis of Nuclear piRNAs from Cytosolic Targets of the Mouse piRNA Pathway.
Mol. Cell (2016) 61(1) 138-52 [ PubMed ID = 26669262 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAAAGACCTGGCAGAGCAGC 
 Primer Seq. 3'
aatctagaggtaccTTCTTATGCGCCTTGCGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAAAAGACCT GGCAGAGCAG CAGAGACTCA GTCTACGAAG TTGGCGACTC GTATAGCGGC 
0061 CAGAATGCCA ATCGACCTCT GGTGGCCACG AACTGCTCCG AATATGCGGT GGCCCATGCA 
0121 AACTGCCAGT TGCGTCCGGT TCGTCGATTT GCGGAGGTTT CTCTTCTGCC GGACATCCTG 
0181 GAAACCATGA GAAACTTGGG CCTAAACCGG TTGCTCCGAC TGCAAAGCTA CACATGGCCA 
0241 CACTTGGCCG GAGGATCTGG GCACGGGGCG ATGATTGTGG GGTCTCCGGC CAGTGGTCGC 
0301 ACTTTTGCTT ATATACCACC TGTTTGCCAT GCTGTTTCCA GAGCTCTAAT GGATTTCACA 
0361 GGTCAGTGCG AGGATGTGGA GCACGATATC TCTCAACCGG ATCGCTATGG CCCCATAGCA 
0421 TTGATCCTCG TACCGGATCT GCGACGCGTT CACCAGGTCA GCGCGATGTG TCTANGCCCT 
0481 GCTGCGCAAG GCGCATAAGA A 
 in silico PCR Fragment
0001 GAAAAGACCT GGCAGAGCAG CAGAGACTCA GTCTACGAAG TTGGCGACTC GTATAGCGGC 
0061 CAGAATGCCA ATCGACCTCT GGTGGCCACG AACTGCTCCG AATATGCGGT GGCCCATGCA 
0121 AACTGCCAGT TGCGTCCGGT TCGTCGATTT GCGGAGGTTT CTCTTCTGCC GGACATCCTG 
0181 GAAACCATGA GAAACTTGGG CCTAAACCGG TTGCTCCGAC TGCAAAGCTA CACATGGCCA 
0241 CACTTGGCCG GAGGATCTGG GCACGGGGCG ATGATTGTGG GGTCTCCGGC CAGTGGTCGC 
0301 ACTTTTGCTT ATATACCACC TGTTTGCCAT GCTGTTTCCA GAGCTCTAAT GGATTTCACA 
0361 GGTCAGTGCG AGGATGTGGA GCACGATATC TCTCAACCGG ATCGCTATGG CCCCATAGCA 
0421 TTGATCCTCG TACCGGATCT GCGACGCGTT CACCAGGTCA GCGCGATGTG TCTA-GCCCT 
0481 GCTGCGCAAG GCGCATAAGA A 
 Assemble Data

11133R-1.IR_full       1   GAAAAGACCTGGCAGAGCAGCAGAGACTCAGTCTACGAAGTTGGCGACTCGTATAGCGGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     1   GAAAAGACCTGGCAGAGCAGCAGAGACTCAGTCTACGAAGTTGGCGACTCGTATAGCGGC 60


11133R-1.IR_full       61  CAGAATGCCAATCGACCTCTGGTGGCCACGAACTGCTCCGAATATGCGGTGGCCCATGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     61  CAGAATGCCAATCGACCTCTGGTGGCCACGAACTGCTCCGAATATGCGGTGGCCCATGCA 120


11133R-1.IR_full       121 AACTGCCAGTTGCGTCCGGTTCGTCGATTTGCGGAGGTTTCTCTTCTGCCGGACATCCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     121 AACTGCCAGTTGCGTCCGGTTCGTCGATTTGCGGAGGTTTCTCTTCTGCCGGACATCCTG 180


11133R-1.IR_full       181 GAAACCATGAGAAACTTGGGCCTAAACCGGTTGCTCCGACTGCAAAGCTACACATGGCCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     181 GAAACCATGAGAAACTTGGGCCTAAACCGGTTGCTCCGACTGCAAAGCTACACATGGCCA 240


11133R-1.IR_full       241 CACTTGGCCGGAGGATCTGGGCACGGGGCGATGATTGTGGGGTCTCCGGCCAGTGGTCGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     241 CACTTGGCCGGAGGATCTGGGCACGGGGCGATGATTGTGGGGTCTCCGGCCAGTGGTCGC 300


11133R-1.IR_full       301 ACTTTTGCTTATATACCACCTGTTTGCCATGCTGTTTCCAGAGCTCTAATGGATTTCACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     301 ACTTTTGCTTATATACCACCTGTTTGCCATGCTGTTTCCAGAGCTCTAATGGATTTCACA 360


11133R-1.IR_full       361 GGTCAGTGCGAGGATGTGGAGCACGATATCTCTCAACCGGATCGCTATGGCCCCATAGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11133R-1.in silico     361 GGTCAGTGCGAGGATGTGGAGCACGATATCTCTCAACCGGATCGCTATGGCCCCATAGCA 420


11133R-1.IR_full       421 TTGATCCTCGTACCGGATCTGCGACGCGTTCACCAGGTCAGCGCGATGTGTCTANGCCCT 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
11133R-1.in silico     421 TTGATCCTCGTACCGGATCTGCGACGCGTTCACCAGGTCAGCGCGATGTGTCTA-GCCCT 480


11133R-1.IR_full       481 GCTGCGCAAGGCGCATAAGAA 501
                           |||||||||||||||||||||
11133R-1.in silico     481 GCTGCGCAAGGCGCATAAGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141173.1  CG11133-RA (CG11133), mRNA 
0   NM_140188.2  CG6210-RA, transcript variant A (srt), mRNA 
0   NM_168450.1  CG6210-RB, transcript variant B (srt), mRNA 
0   NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_079867.2  CG12220-RA (mRpL32), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_058039.2  CG11325-RA, transcript variant A (GRHR), mRNA 
0   NM_205917.1  CG11325-RC, transcript variant C (GRHR), mRNA 
0   NM_164705.1  CG11325-RB, transcript variant B (GRHR), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_169057.1  CG31547-RB, transcript variant B (CG31547), mRNA 
0   NM_169058.1  CG31547-RA, transcript variant A (CG31547), mRNA 
0   NM_058049.4  CG6759-RA (cdc16), mRNA 
0   10  NM_167368.1  CG1640-RE, transcript variant E (CG1640), mRNA 
0   10  NM_167369.1  CG1640-RF, transcript variant F (CG1640), mRNA 
0   10  NM_167367.1  CG1640-RD, transcript variant D (CG1640), mRNA 
0   10  NM_132651.2  CG1640-RA, transcript variant A (CG1640), mRNA 
0   10  NM_167366.1  CG1640-RC, transcript variant C (CG1640), mRNA 
0   10  NM_167365.1  CG1640-RB, transcript variant B (CG1640), mRNA 
0   NM_132210.2  CG2257-RB, transcript variant B (Ubc-E2H), mRNA 
0   NM_167145.1  CG2257-RA, transcript variant A (Ubc-E2H), mRNA 
0   NM_167146.1  CG2257-RC, transcript variant C (Ubc-E2H), mRNA 
0   NM_137977.2  CG11299-RA (CG11299), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_143679.3  CG1793-RA, transcript variant A (MED26), mRNA 
0   NM_166791.1  CG1793-RB, transcript variant B (MED26), mRNA 
0   NM_132543.1  CG10362-RA (CG10362), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.