National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11107R-2 
 Symbol CG11107  Full Name CG11107 
 CG No CG11107  Old CG No CG11107 
 Synonyms cg11107, clone 1.18, anon-EST:Liang-1.18, CG11107 
 Accession No (Link to NCBI) NM_136425.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mosallanejad K, Sekine Y, Ishikura-Kinoshita S, Kumagai K, Nagano T, Matsuzawa A, Takeda K, Naguro I, Ichijo H.
The DEAH-box RNA helicase DHX15 activates NF-κB and MAPK signaling downstream of MAVS during antiviral responses.
Sci Signal (2014) 7(323) ra40 [ PubMed ID = 24782566 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGAAGCGCATTGCGCTGCCC 
 Primer Seq. 3'
aatctagaggtaccAACTTGCCGGCGTCCAGTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGAAGCGCA TTGcGCTGCC CGTGTTCGAG TACCAGGCGG ACTTTATGCG GCTGCTCAGC 
0061 CTGCACCAGT GTATTGTGCT GGTGGGCGAG ACTGGCTCCG GCAAGACGAC CCAGATCCCG 
0121 CAGTGGTGCG TGGACTTCGC AGTATCCAAG GGGCGCAAGG GAGTCTCCTG CACACAGCCA 
0181 CGTCGAGTTG CCGCCATGTC CGTGGCCCAG CGCGTTTCGG AGGAGATGGA CGTAAAACTG 
0241 GGCGAAGAGG TCGGCTACTC CATCCGTTTC GAGGACTGCT CCACGGCCAA GACGCTGCTC 
0301 AAGTACATGA CCGATGGTAT GTTGTTGCGC GAGGCCATGT CTGATCCCAT GCTGGACCAG 
0361 TACCAGGTCA TTCTGCTTGA CGAGGCTCAC GAGCGGACCT TGGCCACTGA CATTCTAATG 
0421 GGCGTGCTCA AGGAGGTCAT TCGTCAGCGC AGCGACCTTA AGCTGGTGGT CATGTCCGCC 
0481 ACACTGGACG CCGGCAAGTT  
 in silico PCR Fragment
0001 AAGAAGCGCA TTGCGCTGCC CGTGTTCGAG TACCAGGCGG ACTTTATGCG GCTGCTCAGC 
0061 CTGCACCAGT GTATTGTGCT GGTGGGCGAG ACTGGCTCCG GCAAGACGAC CCAGATCCCG 
0121 CAGTGGTGCG TGGACTTCGC AGTATCCAAG GGGCGCAAGG GAGTCTCCTG CACACAGCCA 
0181 CGTCGAGTTG CCGCCATGTC CGTGGCCCAG CGCGTTTCGG AGGAGATGGA CGTAAAACTG 
0241 GGCGAAGAGG TCGGCTACTC CATCCGTTTC GAGGACTGCT CCACGGCCAA GACGCTGCTC 
0301 AAGTACATGA CCGATGGTAT GTTGTTGCGC GAGGCCATGT CTGATCCCAT GCTGGACCAG 
0361 TACCAGGTCA TTCTGCTTGA CGAGGCTCAC GAGCGGACCT TGGCCACTGA CATTCTAATG 
0421 GGCGTGCTCA AGGAGGTCAT TCGTCAGCGC AGCGACCTTA AGCTGGTGGT CATGTCCGCC 
0481 ACACTGGACG CCGGCAAGTT  
 Assemble Data

11107R-2.IR_full       1   AAGAAGCGCATTGCGCTGCCCGTGTTCGAGTACCAGGCGGACTTTATGCGGCTGCTCAGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     1   AAGAAGCGCATTGCGCTGCCCGTGTTCGAGTACCAGGCGGACTTTATGCGGCTGCTCAGC 60


11107R-2.IR_full       61  CTGCACCAGTGTATTGTGCTGGTGGGCGAGACTGGCTCCGGCAAGACGACCCAGATCCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     61  CTGCACCAGTGTATTGTGCTGGTGGGCGAGACTGGCTCCGGCAAGACGACCCAGATCCCG 120


11107R-2.IR_full       121 CAGTGGTGCGTGGACTTCGCAGTATCCAAGGGGCGCAAGGGAGTCTCCTGCACACAGCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     121 CAGTGGTGCGTGGACTTCGCAGTATCCAAGGGGCGCAAGGGAGTCTCCTGCACACAGCCA 180


11107R-2.IR_full       181 CGTCGAGTTGCCGCCATGTCCGTGGCCCAGCGCGTTTCGGAGGAGATGGACGTAAAACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     181 CGTCGAGTTGCCGCCATGTCCGTGGCCCAGCGCGTTTCGGAGGAGATGGACGTAAAACTG 240


11107R-2.IR_full       241 GGCGAAGAGGTCGGCTACTCCATCCGTTTCGAGGACTGCTCCACGGCCAAGACGCTGCTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     241 GGCGAAGAGGTCGGCTACTCCATCCGTTTCGAGGACTGCTCCACGGCCAAGACGCTGCTC 300


11107R-2.IR_full       301 AAGTACATGACCGATGGTATGTTGTTGCGCGAGGCCATGTCTGATCCCATGCTGGACCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     301 AAGTACATGACCGATGGTATGTTGTTGCGCGAGGCCATGTCTGATCCCATGCTGGACCAG 360


11107R-2.IR_full       361 TACCAGGTCATTCTGCTTGACGAGGCTCACGAGCGGACCTTGGCCACTGACATTCTAATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     361 TACCAGGTCATTCTGCTTGACGAGGCTCACGAGCGGACCTTGGCCACTGACATTCTAATG 420


11107R-2.IR_full       421 GGCGTGCTCAAGGAGGTCATTCGTCAGCGCAGCGACCTTAAGCTGGTGGTCATGTCCGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11107R-2.in silico     421 GGCGTGCTCAAGGAGGTCATTCGTCAGCGCAGCGACCTTAAGCTGGTGGTCATGTCCGCC 480


11107R-2.IR_full       481 ACACTGGACGCCGGCAAGTT 500
                           ||||||||||||||||||||
11107R-2.in silico     481 ACACTGGACGCCGGCAAGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136425.2  CG11107-RA (CG11107), mRNA 
0.41   20  55  NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0.2   23  40  NM_136102.2  CG10689-RA (CG10689), mRNA 
0.2   NM_136633.2  CG2072-RA (TXBP181-like), mRNA 
0   10  21  NM_135512.2  CG4901-RA (CG4901), mRNA 
0   NM_166631.1  CG5594-RA, transcript variant A (CG5594), mRNA 
0   NM_166630.1  CG5594-RD, transcript variant D (CG5594), mRNA 
0   NM_131901.2  CG5594-RC, transcript variant C (CG5594), mRNA 
0   NM_166632.1  CG5594-RB, transcript variant B (CG5594), mRNA 
0   NM_168258.1  CG7404-RA, transcript variant A (ERR), mRNA 
0   NM_139926.1  CG7404-RB, transcript variant B (ERR), mRNA 
0   NM_001031942.1  CG33717-RA, transcript variant A (PGRP-LD), mRNA 
0   NM_001031940.1  CG33717-RC, transcript variant C (PGRP-LD), mRNA 
0   NM_001031941.1  CG33717-RB, transcript variant B (PGRP-LD), mRNA 
0   NM_001031938.1  CG33718-RB, transcript variant B (Pmi), mRNA 
0   NM_001031939.1  CG33718-RA, transcript variant A (Pmi), mRNA 
0   NM_079215.1  CG10546-RA (Cralbp), mRNA 
0   NM_166560.1  CG30271-RC (CG30271), mRNA 
0   NM_135039.1  CG3753-RA (Marcal1), mRNA 
0   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_080522.2  CG9748-RA (bel), mRNA 
0   10  NM_141174.1  CG12768-RA (CG12768), mRNA 
0   NM_135016.2  CG3225-RA (CG3225), mRNA 
0   NM_144395.3  CG18754-RA (CG18754), mRNA 
0   NM_057619.3  CG3710-RA (TfIIS), mRNA 
0   NM_132990.2  CG8557-RA, transcript variant A (CG8557), mRNA 
0   NM_176751.1  CG8557-RB, transcript variant B (CG8557), mRNA 
0   NM_144236.1  CG17757-RA (CG17757), mRNA 
0   NM_170111.1  CG5410-RD, transcript variant D (Miro), mRNA 
0   NM_142948.2  CG5410-RE, transcript variant E (Miro), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.