National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11101R-3 
 Symbol pwn  Full Name pawn 
 CG No CG11101  Old CG No CG11101 
 Synonyms CG11101, CT31067, l(2)pwn, pwn 
 Accession No (Link to NCBI) NM_136423.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees eye color, briste loss, male semi-lethal 
 Map Viewer
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            |||||||||||||||||| ||||||||  |||||||||||||||||||||||||||||| silico     1   TCTGGCCGAAGGCCAATCA-TCGCCCCT--GGATGTGAACGATAACGAAACGCGGGCGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGAGTGGAGCGCTCGGCGTCGCCCATTCTGCATGATCGGCAGCCAATCGGACCCAACGA 120

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTGCACTTCCCTGAGGATCTGGAAAAGGACGTGTCCGCCGGACGGTACTTCCACTACAA 180

                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     181 CATCAAGCCCACGGGCACCTTCGACAACCAGGATGAGC-AGCCGGAGCGTACGCACCAGG 240

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      241 GGATCAGGGCTGGGAAGACCCTGTCGCAAGGTGGCAGCAGCTCAGAGCAGTCTTTTTTA 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGCGGGGGGACCTGCGACCGCTAGTGTCGGGGTCCCCGATTCGGCCGAGTCCGAGCAAT 359

                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || silico     361 ACTGCCACCTCAGCTACGGCAGCCAGTGCCACCCAGGCGCCGCATAGTCCGCGCCAG-AA 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     421 CGGAAACCCCGACATCCAGGACATCATCACAGGCATCGTCAAGCTGCTGAATGGCAATGT 479

                           ||||||||||||||||||||   |||||| silico     481 CAATGTCCATGCTAATACGC---AGGGCA 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136423.1  CG11101-RA (pwn), mRNA 
0.41   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0.2   NM_206290.1  CG33279-RA (CG33279), mRNA 
0   NM_134888.2  CG3165-RA (CG3165), mRNA 
0   NM_001038944.1  CG8567-RB, transcript variant B (Deaf1), mRNA 
0   NM_079445.2  CG8567-RA, transcript variant A (Deaf1), mRNA 
0   NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_140458.1  CG17177-RA (CG17177), mRNA 
0   NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
0   NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0   NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
0   NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
0   NM_170079.2  CG31145-RA, transcript variant A (CG31145), mRNA 
0   NM_176547.1  CG31145-RB, transcript variant B (CG31145), mRNA 
0   NM_140379.1  CG14111-RA (CG14111), mRNA 
0   NM_165330.2  CG31683-RA (CG31683), mRNA 
0   NM_142719.1  CG15497-RA (CG15497), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   NM_140716.1  CG6445-RA, transcript variant A (Cad74A), mRNA 
0   NM_168724.1  CG6445-RB, transcript variant B (Cad74A), mRNA 
0   NM_140959.1  CG5701-RA (RhoBTB), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.