National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11101R-2 
 Symbol pwn  Full Name pawn 
 CG No CG11101  Old CG No CG11101 
 Synonyms CG11101, CT31067, l(2)pwn, pwn 
 Accession No (Link to NCBI) NM_136423.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal, male escaper abnormal eye color, bristle loss 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGGCCGAAGGCCAATCATC 
 Primer Seq. 3'
aatctagaggtaccTGCCCTGCGTATTAGCATGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGGCCGAA GGCCAATCAN TCGCCCCTTN GGATGTGAAC GATAACGAAA CGCGGGCGGA 
0061 GCGAGTGGAG CGCTCGGCGT CGCCCATTCT GCATGATCGG CAGCCAATCG GACCCAACGA 
0121 CGTGCACTTC CCTGAGGATC TGGAAAAGGA CGTGTCCGCC GGACGGTACT TCCACTACAA 
0181 CATCAAGCCC ACGGGCACCT TCGACAACCA GGATGAGCAA GCCGGAGCGT ACGCACCAGG 
0241 NGGATCAGGG CTGGGAAGAC CCTGTCGCAA GGTGGCAGCA GCTCAGAGCA GTCTTTTTTA 
0301 GGGCGGGGGG ACCTGCGACC GCTAGTGTCG GGGTCCCCGA TTCGGCCGAG TCCGAGCAAT 
0361 ACTGCCACCT CAGCGACGGC AGCCAGTGCC ACCCAGGCGC CGCATAGTCC GCGCCAGAAA 
0421 CGGAAACCCC GACATCCAGG ACATCATCAC AGGCATCGTC AAGCTGCTGA ATGGTAATGT 
0481 CAATGTCCAT GCTAATACGC GGGAGGGCA 
 in silico PCR Fragment
0001 TCTGGCCGAA GGCCAATCA- TCGCCCCT-- GGATGTGAAC GATAACGAAA CGCGGGCGGA 
0061 GCGAGTGGAG CGCTCGGCGT CGCCCATTCT GCATGATCGG CAGCCAATCG GACCCAACGA 
0121 TGTGCACTTC CCTGAGGATC TGGAAAAGGA CGTGTCCGCC GGACGGTACT TCCACTACAA 
0181 CATCAAGCCC ACGGGCACCT TCGACAACCA GGATGAGC-A GCCGGAGCGT ACGCACCAGG 
0241 -GGATCAGGG CTGGGAAGAC CCTGTCGCAA GGTGGCAGCA GCTCAGAGCA GTCTTTTTTA 
0301 GGGCGGGGGG ACCTGCGACC GCTAGTGTCG GGGTCCCCGA TTCGGCCGAG TCCGAGCAAT 
0361 ACTGCCACCT CAGCTACGGC AGCCAGTGCC ACCCAGGCGC CGCATAGTCC GCGCCAG-AA 
0421 CGGAAACCCC GACATCCAGG ACATCATCAC AGGCATCGTC AAGCTGCTGA ATGGCAATGT 
0481 CAATGTCCAT GCTAATACGC ---AGGGCA 
 Assemble Data

11101R-2.IR_full       1   CCTGGCCGAAGGCCAATCANTCGCCCCTTNGGATGTGAACGATAACGAAACGCGGGCGGA 60
                            |||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||
11101R-2.in silico     1   TCTGGCCGAAGGCCAATCA-TCGCCCCT--GGATGTGAACGATAACGAAACGCGGGCGGA 60


11101R-2.IR_full       61  GCGAGTGGAGCGCTCGGCGTCGCCCATTCTGCATGATCGGCAGCCAATCGGACCCAACGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11101R-2.in silico     61  GCGAGTGGAGCGCTCGGCGTCGCCCATTCTGCATGATCGGCAGCCAATCGGACCCAACGA 120


11101R-2.IR_full       121 CGTGCACTTCCCTGAGGATCTGGAAAAGGACGTGTCCGCCGGACGGTACTTCCACTACAA 180
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11101R-2.in silico     121 TGTGCACTTCCCTGAGGATCTGGAAAAGGACGTGTCCGCCGGACGGTACTTCCACTACAA 180


11101R-2.IR_full       181 CATCAAGCCCACGGGCACCTTCGACAACCAGGATGAGCAAGCCGGAGCGTACGCACCAGG 240
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
11101R-2.in silico     181 CATCAAGCCCACGGGCACCTTCGACAACCAGGATGAGC-AGCCGGAGCGTACGCACCAGG 240


11101R-2.IR_full        241 GGATCAGGGCTGGGAAGACCCTGTCGCAAGGTGGCAGCAGCTCAGAGCAGTCTTTTTTA 299
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11101R-2.in silico      241 GGATCAGGGCTGGGAAGACCCTGTCGCAAGGTGGCAGCAGCTCAGAGCAGTCTTTTTTA 299


11101R-2.IR_full       301 GGGCGGGGGGACCTGCGACCGCTAGTGTCGGGGTCCCCGATTCGGCCGAGTCCGAGCAAT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11101R-2.in silico     301 GGGCGGGGGGACCTGCGACCGCTAGTGTCGGGGTCCCCGATTCGGCCGAGTCCGAGCAAT 359


11101R-2.IR_full       361 ACTGCCACCTCAGCGACGGCAGCCAGTGCCACCCAGGCGCCGCATAGTCCGCGCCAGAAA 419
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||
11101R-2.in silico     361 ACTGCCACCTCAGCTACGGCAGCCAGTGCCACCCAGGCGCCGCATAGTCCGCGCCAG-AA 419


11101R-2.IR_full       421 CGGAAACCCCGACATCCAGGACATCATCACAGGCATCGTCAAGCTGCTGAATGGTAATGT 479
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
11101R-2.in silico     421 CGGAAACCCCGACATCCAGGACATCATCACAGGCATCGTCAAGCTGCTGAATGGCAATGT 479


11101R-2.IR_full       481 CAATGTCCATGCTAATACGCGGGAGGGCA 508
                           ||||||||||||||||||||   ||||||
11101R-2.in silico     481 CAATGTCCATGCTAATACGC---AGGGCA 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136423.1  CG11101-RA (pwn), mRNA 
0.41   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0.2   NM_206290.1  CG33279-RA (CG33279), mRNA 
0   NM_134888.2  CG3165-RA (CG3165), mRNA 
0   NM_001038944.1  CG8567-RB, transcript variant B (Deaf1), mRNA 
0   NM_079445.2  CG8567-RA, transcript variant A (Deaf1), mRNA 
0   NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_140458.1  CG17177-RA (CG17177), mRNA 
0   NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
0   NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0   NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
0   NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
0   NM_170079.2  CG31145-RA, transcript variant A (CG31145), mRNA 
0   NM_176547.1  CG31145-RB, transcript variant B (CG31145), mRNA 
0   NM_140379.1  CG14111-RA (CG14111), mRNA 
0   NM_165330.2  CG31683-RA (CG31683), mRNA 
0   NM_142719.1  CG15497-RA (CG15497), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   NM_140716.1  CG6445-RA, transcript variant A (Cad74A), mRNA 
0   NM_168724.1  CG6445-RB, transcript variant B (Cad74A), mRNA 
0   NM_140959.1  CG5701-RA (RhoBTB), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.