National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11093R-3 
 Symbol CG11093  Full Name CG11093 
 CG No CG11093  Old CG No CG11093 
 Synonyms CG11093 
 Accession No (Link to NCBI) NM_143689.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fischer S, Bayersdorfer F, Harant E, Reng R, Arndt S, Bosserhoff AK, Schneuwly S.
fussel (fuss)--A negative regulator of BMP signaling in Drosophila melanogaster.
PLoS One (2012) 7(8) e42349 [ PubMed ID = 22879948 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTGTACGGAGTGCAGATTG 
 Primer Seq. 3'
aatctagaggtaccACGCCAGGAATTAAAGTTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCTGTACGG AGTGCAGATT GTATCCCTGC ACATTGAAGG TCAAGAGCGC CTTTGCTTGG 
0061 CGCAAATTTC AAATACATTA CTAAAACAAT TCAGTTACAA CGAGATACAC AACAGGAGAG 
0121 TTGCTCTTGG CATTACTTGT GTACAATGTA CACCCGTGCA ATTGGAAATA TTGAGAAGAG 
0181 CTGGCGCCAT GCCAGTGAGT TCCCGACGAT GTGGCATGAT TACCCGCAGG GAAGCGGAGC 
0241 GTCTTATGCA AAAGTTTCTT GGGCGACAAT ACACCACCAC GACTACCTGA CGACTTTGCG 
0301 TTTAACGTNC CAGCACAAAT GTGCTTGGGG CTGCCGCGGA TCCTTTCTAC CCTCGCGTTA 
0361 CAACTCATCA AGGGCTAAGT GCATTAAGTG TTCATATTGC GGAATGTTTT TCTCGCCCAA 
0421 TAAATTTATT TTTCACTCAC ATCGCATAAC AACTAATGAC AGGTACGTTC AGCCTGATGC 
0481 AGCGAACTTT AATTCCTGGC GT 
 in silico PCR Fragment
0001 TGCTGTACGG AGTGCAGATT GTATCCCTGC ACATTGAAGG TCAAGAGCGC CTTTGCTTGG 
0061 CGCAAATTTC AAATACATTA CTAAAACAAT TCAGTTACAA CGAGATACAC AACAGGAGAG 
0121 TTGCTCTTGG CATTACTTGT GTACAATGTA CACCCGTGCA ATTGGAAATA TTGAGAAGAG 
0181 CTGGCGCCAT GCCAGTGAGT TCCCGACGAT GTGGCATGAT TACCCGCAGG GAAGCGGAGC 
0241 GTC-TATGCA AAAGTTTCTT GGGCGACAAT ACACCACCAC GACTACCTGA CGACTTTGCG 
0301 TTTAACGT-C CAGCACAAAT GTGCTTGGGG CTGCCGCGGA TCCTTTCTAC CCTCGCGTTA 
0361 CAACTCATCA AGGGCTAAGT GCATTAAGTG TTCATATTGC GGAATGTTTT TCTCGCCCAA 
0421 TAAATTTATT TTTCACTCAC ATCGCATAAC AACTAATGAC AGGTACGTTC AGCCTGATGC 
0481 AGCGAACTTT AATTCCTGGC GT 
 Assemble Data

11093R-3.IR_full       1   TGCTGTACGGAGTGCAGATTGTATCCCTGCACATTGAAGGTCAAGAGCGCCTTTGCTTGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     1   TGCTGTACGGAGTGCAGATTGTATCCCTGCACATTGAAGGTCAAGAGCGCCTTTGCTTGG 60


11093R-3.IR_full       61  CGCAAATTTCAAATACATTACTAAAACAATTCAGTTACAACGAGATACACAACAGGAGAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     61  CGCAAATTTCAAATACATTACTAAAACAATTCAGTTACAACGAGATACACAACAGGAGAG 120


11093R-3.IR_full       121 TTGCTCTTGGCATTACTTGTGTACAATGTACACCCGTGCAATTGGAAATATTGAGAAGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     121 TTGCTCTTGGCATTACTTGTGTACAATGTACACCCGTGCAATTGGAAATATTGAGAAGAG 180


11093R-3.IR_full       181 CTGGCGCCATGCCAGTGAGTTCCCGACGATGTGGCATGATTACCCGCAGGGAAGCGGAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     181 CTGGCGCCATGCCAGTGAGTTCCCGACGATGTGGCATGATTACCCGCAGGGAAGCGGAGC 240


11093R-3.IR_full       241 GTCTTATGCAAAAGTTTCTTGGGCGACAATACACCACCACGACTACCTGACGACTTTGCG 300
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     241 GTC-TATGCAAAAGTTTCTTGGGCGACAATACACCACCACGACTACCTGACGACTTTGCG 300


11093R-3.IR_full       301 TTTAACGTNCCAGCACAAATGTGCTTGGGGCTGCCGCGGATCCTTTCTACCCTCGCGTTA 360
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     301 TTTAACGT-CCAGCACAAATGTGCTTGGGGCTGCCGCGGATCCTTTCTACCCTCGCGTTA 360


11093R-3.IR_full       361 CAACTCATCAAGGGCTAAGTGCATTAAGTGTTCATATTGCGGAATGTTTTTCTCGCCCAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     361 CAACTCATCAAGGGCTAAGTGCATTAAGTGTTCATATTGCGGAATGTTTTTCTCGCCCAA 420


11093R-3.IR_full       421 TAAATTTATTTTTCACTCACATCGCATAACAACTAATGACAGGTACGTTCAGCCTGATGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11093R-3.in silico     421 TAAATTTATTTTTCACTCACATCGCATAACAACTAATGACAGGTACGTTCAGCCTGATGC 480


11093R-3.IR_full       481 AGCGAACTTTAATTCCTGGCGT 502
                           ||||||||||||||||||||||
11093R-3.in silico     481 AGCGAACTTTAATTCCTGGCGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143689.1  CG11093-RA (CG11093), mRNA 
0   NM_139554.3  CG12076-RA, transcript variant A (YT521-B), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_078637.2  CG9209-RB, transcript variant B (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_132069.2  CG32754-RA (vanin-like), mRNA 
0   NM_169068.2  CG1081-RA, transcript variant A (Rheb), mRNA 
0   NM_132826.2  CG9240-RA (CG9240), mRNA 
0   NM_169069.2  CG1081-RB, transcript variant B (Rheb), mRNA 
0   11  NM_167870.1  CG9155-RA, transcript variant A (Myo61F), mRNA 
0   11  NM_167872.1  CG9155-RC, transcript variant C (Myo61F), mRNA 
0   11  NM_167871.1  CG9155-RB, transcript variant B (Myo61F), mRNA 
0   11  NM_057586.3  CG9155-RD, transcript variant D (Myo61F), mRNA 
0   NM_205947.1  CG3858-RB, transcript variant B (gcm2), mRNA 
0   NM_135021.2  CG12194-RA (CG12194), mRNA 
0   NM_135458.3  CG3858-RA, transcript variant A (gcm2), mRNA 
0   NM_140276.2  CG6947-RA (CG6947), mRNA 
0   14  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_206460.1  CG33325-RA (CG33325), mRNA 
0   NM_143596.2  CG12054-RA (CG12054), mRNA 
0   NM_134642.2  CG11371-RB (dbr), mRNA 
0   NM_139485.1  CG12187-RA (CG12187), mRNA 
0   NM_139980.2  CG6662-RA (CG6662), mRNA 
0   NM_141438.2  CG10068-RA (CG10068), mRNA 
0   NM_142829.1  CG4907-RA (CG4907), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.