National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11066R-2 
 Symbol scarface  Full Name scarface 
 CG No CG11066  Old CG No CG11066 
 Synonyms CG11066, CG15900, SPH142, scarface 
 Accession No (Link to NCBI) NM_165441.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ACTACCGGGCCAACATGTTTCTCAATGGCCAATATCAAAACGGTATCAAGGATCAAAAG 59

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGAACAACCTTTTAGTAAACCCCTCGACGAACGTGTTCCTCAACCACGCCATAATCAGC 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGGCAAGCGTCGCCGTTCCAGGGCCCAACCTATCTGCCGCCCAAGGAGTTCCTGAAGTGC 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTCCCGGCCAGCAGTGCGTCCGCAGTGGTCAGTGCCTGAACGGATATTTCGCCCAGCAA 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCCCAAGATTCAAAACTGTGATCCGGAAACCACCGTTTGCTGTACTTACAGGCCGCCT 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCACCACCACAACAACAACCACTACTTCCGTGCCAGTGGCCAATTGTGCCTACGACTCC 359

                           ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     361 GACTGTGTGACTCCGGACA-ACTGCCGGAACGGCGAAATTAGCGCCATAAACTACGTAAA 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAAGCAAGGACCCAACCGCTGCCCTGCTCCTAATATATGCTGCCGCATACCCTCGACCAC 479

11066R-2.IR_full       481 GCTAACGGAGGATGGGTACAT 500
                           ||||||||||||||||||||| silico     481 GCTAACGGAGGATGGGTACAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  NM_136336.2  CG11066-RB, transcript variant B (scarface), mRNA 
100   482  14  NM_165441.1  CG11066-RA, transcript variant A (scarface), mRNA 
1.65   24  NM_206322.1  CG33500-RA (CG33500), mRNA 
1.65   17  NM_141297.1  CG2926-RA (CG2926), mRNA 
1.24   27  82  NM_136593.1  CG8181-RA (CG8181), mRNA 
1.03   16  NM_169716.1  CG14880-RB, transcript variant B (CG14880), mRNA 
1.03   16  NM_142281.2  CG14880-RA, transcript variant A (CG14880), mRNA 
0.82   11  21  NM_206327.1  CG33271-RA (CG33271), mRNA 
0.82   11  20  NM_206329.1  CG33269-RA (CG33269), mRNA 
0.82   11  20  NM_206323.1  CG33272-RA (CG33272), mRNA 
0.82   14  NM_206328.1  CG33270-RA (CG33270), mRNA 
0.2   10  12  NM_057525.2  CG7937-RA (C15), mRNA 
0.2   24  51  NM_001014630.1  CG33547-RA (Rim), mRNA 
0.2   14  13  NM_001043116.1  CG10579-RF, transcript variant F (Eip63E), mRNA 
0.2   14  13  NM_168033.1  CG10579-RE, transcript variant E (Eip63E), mRNA 
0.2   14  13  NM_079180.2  CG10579-RD, transcript variant D (Eip63E), mRNA 
0   34  121  184  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   10  27  67  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   29  125  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   16  20  NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   16  20  NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   16  20  NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   12  60  NM_136854.1  CG13194-RA (pyr), mRNA 
0   16  NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0   16  NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0   16  NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0   16  NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0   16  NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0   10  22  NM_166976.1  CG32791-RA (CG32791), mRNA 
0   12  NM_078663.2  CG5529-RA (B-H1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.