National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11066R-1 
 Symbol scarface  Full Name scarface 
 CG No CG11066  Old CG No CG11066 
 Synonyms CG11066, CG15900, SPH142, scarface 
 Accession No (Link to NCBI) NM_165441.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fukui A, Inaki M, Tonoe G, Hamatani H, Homma M, Morimoto T, Aburatani H, Nose A.
Lola regulates glutamate receptor expression at the Drosophila neuromuscular junction.
Biol Open (2012) 1(4) 362-75 [ PubMed ID = 23213426 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACTACCGGGCCAACATGTTT 
 Primer Seq. 3'
aatctagaggtaccATGTACCCATCCTCCGTTAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NACTACCGGG CCAACATGTT TCTCAATGGC CAATATCAAA ACGGTATCAA GGATCAAAAG 
0061 GAGAACCACC TTTTAGTAAA CCCCTCGACG AACGTGTTCC TCAACCACGC CATAATCAGC 
0121 AGGCAAGCGT CGCCGTTCCA GGGCCCAACC TATCTGCCGC CCAAGGAGTT CCTGAAGTGC 
0181 GCTCCCGGCC AGCAGTGCGT CCGCAGTGGT CAGTGCCTGA ACGGATATTT CGCCCAGCAA 
0241 CTGCCCAAGA TTCAAAACTG TGATCCGGAA ACCACCGTTT GCTGTACTTA CAGGCCGCCT 
0301 CCCACCACCA CAACAACAAC CACTACTTCC GTGCCAGTGG CCAATTGTGC CTACGACTCC 
0361 GACTGTGTGA CTCCGGACAN ACTGCCGGAA CGGCGAAATT AGCGCCATAA ACTACGTAAA 
0421 GAAGCAAGGA CCCAACCGCT GcCCTGCTCC TAATATATGC TGCCGCATAC CCTCGACCAC 
0481 GCTAACGGAG GATGGGTACA T 
 in silico PCR Fragment
0001 GACTACCGGG CCAACATGTT TCTCAATGGC CAATATCAAA ACGGTATCAA GGATCAAAAG 
0061 GAGAACAACC TTTTAGTAAA CCCCTCGACG AACGTGTTCC TCAACCACGC CATAATCAGC 
0121 AGGCAAGCGT CGCCGTTCCA GGGCCCAACC TATCTGCCGC CCAAGGAGTT CCTGAAGTGC 
0181 GCTCCCGGCC AGCAGTGCGT CCGCAGTGGT CAGTGCCTGA ACGGATATTT CGCCCAGCAA 
0241 CTGCCCAAGA TTCAAAACTG TGATCCGGAA ACCACCGTTT GCTGTACTTA CAGGCCGCCT 
0301 CCCACCACCA CAACAACAAC CACTACTTCC GTGCCAGTGG CCAATTGTGC CTACGACTCC 
0361 GACTGTGTGA CTCCGGACA- ACTGCCGGAA CGGCGAAATT AGCGCCATAA ACTACGTAAA 
0421 GAAGCAAGGA CCCAACCGCT GCCCTGCTCC TAATATATGC TGCCGCATAC CCTCGACCAC 
0481 GCTAACGGAG GATGGGTACA T 
 Assemble Data

11066R-1.IR_full        1   ACTACCGGGCCAACATGTTTCTCAATGGCCAATATCAAAACGGTATCAAGGATCAAAAG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico      1   ACTACCGGGCCAACATGTTTCTCAATGGCCAATATCAAAACGGTATCAAGGATCAAAAG 59


11066R-1.IR_full       61  GAGAACCACCTTTTAGTAAACCCCTCGACGAACGTGTTCCTCAACCACGCCATAATCAGC 119
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     61  GAGAACAACCTTTTAGTAAACCCCTCGACGAACGTGTTCCTCAACCACGCCATAATCAGC 119


11066R-1.IR_full       121 AGGCAAGCGTCGCCGTTCCAGGGCCCAACCTATCTGCCGCCCAAGGAGTTCCTGAAGTGC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     121 AGGCAAGCGTCGCCGTTCCAGGGCCCAACCTATCTGCCGCCCAAGGAGTTCCTGAAGTGC 179


11066R-1.IR_full       181 GCTCCCGGCCAGCAGTGCGTCCGCAGTGGTCAGTGCCTGAACGGATATTTCGCCCAGCAA 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     181 GCTCCCGGCCAGCAGTGCGTCCGCAGTGGTCAGTGCCTGAACGGATATTTCGCCCAGCAA 239


11066R-1.IR_full       241 CTGCCCAAGATTCAAAACTGTGATCCGGAAACCACCGTTTGCTGTACTTACAGGCCGCCT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     241 CTGCCCAAGATTCAAAACTGTGATCCGGAAACCACCGTTTGCTGTACTTACAGGCCGCCT 299


11066R-1.IR_full       301 CCCACCACCACAACAACAACCACTACTTCCGTGCCAGTGGCCAATTGTGCCTACGACTCC 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     301 CCCACCACCACAACAACAACCACTACTTCCGTGCCAGTGGCCAATTGTGCCTACGACTCC 359


11066R-1.IR_full       361 GACTGTGTGACTCCGGACANACTGCCGGAACGGCGAAATTAGCGCCATAAACTACGTAAA 419
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     361 GACTGTGTGACTCCGGACA-ACTGCCGGAACGGCGAAATTAGCGCCATAAACTACGTAAA 419


11066R-1.IR_full       421 GAAGCAAGGACCCAACCGCTGCCCTGCTCCTAATATATGCTGCCGCATACCCTCGACCAC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11066R-1.in silico     421 GAAGCAAGGACCCAACCGCTGCCCTGCTCCTAATATATGCTGCCGCATACCCTCGACCAC 479


11066R-1.IR_full       481 GCTAACGGAGGATGGGTACAT 500
                           |||||||||||||||||||||
11066R-1.in silico     481 GCTAACGGAGGATGGGTACAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  NM_136336.2  CG11066-RB, transcript variant B (scarface), mRNA 
100   482  14  NM_165441.1  CG11066-RA, transcript variant A (scarface), mRNA 
1.65   24  NM_206322.1  CG33500-RA (CG33500), mRNA 
1.65   17  NM_141297.1  CG2926-RA (CG2926), mRNA 
1.24   27  82  NM_136593.1  CG8181-RA (CG8181), mRNA 
1.03   16  NM_169716.1  CG14880-RB, transcript variant B (CG14880), mRNA 
1.03   16  NM_142281.2  CG14880-RA, transcript variant A (CG14880), mRNA 
0.82   11  21  NM_206327.1  CG33271-RA (CG33271), mRNA 
0.82   11  20  NM_206329.1  CG33269-RA (CG33269), mRNA 
0.82   11  20  NM_206323.1  CG33272-RA (CG33272), mRNA 
0.82   14  NM_206328.1  CG33270-RA (CG33270), mRNA 
0.2   10  12  NM_057525.2  CG7937-RA (C15), mRNA 
0.2   24  51  NM_001014630.1  CG33547-RA (Rim), mRNA 
0.2   14  13  NM_001043116.1  CG10579-RF, transcript variant F (Eip63E), mRNA 
0.2   14  13  NM_168033.1  CG10579-RE, transcript variant E (Eip63E), mRNA 
0.2   14  13  NM_079180.2  CG10579-RD, transcript variant D (Eip63E), mRNA 
0   34  121  184  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   10  27  67  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   29  125  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   16  20  NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   16  20  NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   16  20  NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   12  60  NM_136854.1  CG13194-RA (pyr), mRNA 
0   16  NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0   16  NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0   16  NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0   16  NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0   16  NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0   10  22  NM_166976.1  CG32791-RA (CG32791), mRNA 
0   12  NM_078663.2  CG5529-RA (B-H1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.