National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11062R-1 
 Symbol activin-beta  Full Name activin-beta 
 CG No CG11062  Old CG No CG11062 
 Synonyms Activin, dact, dAct, dACT, CG11062, anon-WO02059370.79, activin-beta, beta-Activin 
 Accession No (Link to NCBI) NM_143685.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Song W, Cheng D, Hong S, Sappe B, Hu Y, Wei N, Zhu C, O'Connor MB, Pissios P, Perrimon N.
Midgut-Derived Activin Regulates Glucagon-like Action in the Fat Body and Glycemic Control.
Cell Metab (2017) 25(2) 386-399 [ PubMed ID = 28178568 ] [ RRC reference ]

Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev Biol (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev Biol (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATTCAAAGGCAGCAGGTGTT 
 Primer Seq. 3'
aatctagaggtaccCTGTCGTTTACGATTGCGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATTCAAAGG CAGCAGGTGT TTCTTTAATT GTCAATGCAT CTGCTGTCGC CAAGGATGCT 
0061 GCGTTGTGGT TGTAAAGTGC TGTTGCTGCT TTAACTTAAA CTGCTGCAAC AGCCTTGGCT 
0121 CCCGGAAGTC ATTTCCACAA CCCGCTGCAA TGCGTAAAAA AGTTGCTGAC CTCGAAGTCC 
0181 TTAGAGTATC AAGGTTTGTG GCGGTTATTT TAGTGCTGGC TCGGTGGGTT ACTGCGGTAG 
0241 CGACACTCCT GACAAGCTGC ATACTCCTAG ACATATTTTC CGTGCCTGGC CAGTCTGGAG 
0301 TTGCAGATAG AAGCCAAGCC AGCAGTAGGA CAGTGCACGT CTCGGTTCCT ACCACACCTA 
0361 ATGAAACTCC CAGTAGCACT TCGGAGACGA AGCTAAAGTT GCTTTATGGG TATACATCGT 
0421 ATGACATAAA TAACGACCAA CAGGTAAAGT CCAACAATTT ATGTAGAGTG CTTTGTAAAA 
0481 GTCGCAATCG TAAACGACAG  
 in silico PCR Fragment
0001 CATTCAAAGG CAGCAGGTGT TTCTTTAATT GTCAATGCAT CTGCTGTCGC CAAGGATGCT 
0061 GCGTTGTGGT TGTAAAGTGC TGTTGCTGCT TTAACTTAAA CTGCTGCAAC AGCCTTGGCT 
0121 CCCGGAAGTC ATTTCCACAA CCCGCTGCAA TGCGTAAAAA AGTTGCTGAC CTCGAAGTCC 
0181 TTAGAGTATC AAGGTTTGTG GCGGTTATTT TAGTGCTGGC TCGGTGGGTT ACTGCGGTAG 
0241 CGACACTCCT GACAAGCTGC ATACTCCTAG ACATATTTTC CGTGCCTGGC CAGTCTGGAG 
0301 TTGCAGATAG AAGCCAAGCC AGCAGTAGGA CAGTGCACGT CTCGGTTCCT ACCACACCTA 
0361 ATGAAACTCC CAGTAGCACT TCGGAGACGA AGCTAAAGTT GCTTTATGGG TATACATCGT 
0421 ATGACATAAA TAACGACCAA CAGGTAAAGT CCAACAATTT ATGTAGAGTG CTTTGTAAAA 
0481 GTCGCAATCG TAAACGACAG  
 Assemble Data

11062R-1.IR_full       1   CATTCAAAGGCAGCAGGTGTTTCTTTAATTGTCAATGCATCTGCTGTCGCCAAGGATGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     1   CATTCAAAGGCAGCAGGTGTTTCTTTAATTGTCAATGCATCTGCTGTCGCCAAGGATGCT 60


11062R-1.IR_full       61  GCGTTGTGGTTGTAAAGTGCTGTTGCTGCTTTAACTTAAACTGCTGCAACAGCCTTGGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     61  GCGTTGTGGTTGTAAAGTGCTGTTGCTGCTTTAACTTAAACTGCTGCAACAGCCTTGGCT 120


11062R-1.IR_full       121 CCCGGAAGTCATTTCCACAACCCGCTGCAATGCGTAAAAAAGTTGCTGACCTCGAAGTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     121 CCCGGAAGTCATTTCCACAACCCGCTGCAATGCGTAAAAAAGTTGCTGACCTCGAAGTCC 180


11062R-1.IR_full       181 TTAGAGTATCAAGGTTTGTGGCGGTTATTTTAGTGCTGGCTCGGTGGGTTACTGCGGTAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     181 TTAGAGTATCAAGGTTTGTGGCGGTTATTTTAGTGCTGGCTCGGTGGGTTACTGCGGTAG 240


11062R-1.IR_full       241 CGACACTCCTGACAAGCTGCATACTCCTAGACATATTTTCCGTGCCTGGCCAGTCTGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     241 CGACACTCCTGACAAGCTGCATACTCCTAGACATATTTTCCGTGCCTGGCCAGTCTGGAG 300


11062R-1.IR_full       301 TTGCAGATAGAAGCCAAGCCAGCAGTAGGACAGTGCACGTCTCGGTTCCTACCACACCTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     301 TTGCAGATAGAAGCCAAGCCAGCAGTAGGACAGTGCACGTCTCGGTTCCTACCACACCTA 360


11062R-1.IR_full       361 ATGAAACTCCCAGTAGCACTTCGGAGACGAAGCTAAAGTTGCTTTATGGGTATACATCGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     361 ATGAAACTCCCAGTAGCACTTCGGAGACGAAGCTAAAGTTGCTTTATGGGTATACATCGT 420


11062R-1.IR_full       421 ATGACATAAATAACGACCAACAGGTAAAGTCCAACAATTTATGTAGAGTGCTTTGTAAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11062R-1.in silico     421 ATGACATAAATAACGACCAACAGGTAAAGTCCAACAATTTATGTAGAGTGCTTTGTAAAA 480


11062R-1.IR_full       481 GTCGCAATCGTAAACGACAG 500
                           ||||||||||||||||||||
11062R-1.in silico     481 GTCGCAATCGTAAACGACAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143685.2  CG11062-RA (activin-beta), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_137736.1  CG15666-RA (CG15666), mRNA 
0   NM_001015215.1  CG40158-PA.3 (CG40158), mRNA 
0   NM_136412.2  CG4445-RA (pgant3), mRNA 
0   NM_079938.3  CG2102-RA (cas), mRNA 
0   NM_140907.1  CG17732-RA (CG17732), mRNA 
0   NM_168987.1  CG32350-RA (CG32350), mRNA 
0   10  NM_135831.2  CG7578-RA, transcript variant A (sec71), mRNA 
0   10  NM_165059.1  CG7578-RB, transcript variant B (sec71), mRNA 
0   NM_080250.2  CG6224-RA (dbo), mRNA 
0   NM_136011.2  CG7527-RA, transcript variant A (CadN2), mRNA 
0   NM_001042903.1  CG7527-RB, transcript variant B (CadN2), mRNA 
0   NM_142103.1  CG14846-RA (CG14846), mRNA 
0   NM_169659.2  CG14869-RA, transcript variant A (CG14869), mRNA 
0   NM_206496.1  CG14869-RB, transcript variant B (CG14869), mRNA 
0   NM_137031.2  CG4840-RA (CG4840), mRNA 
0   NM_141914.2  CG3942-RA (CG3942), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_136921.1  CG13162-RA (CG13162), mRNA 
0   NM_001043220.1  CG34127-RA (CG34127), mRNA 
0   NM_001032092.1  CG33649-RA, transcript variant A (CG33649), mRNA 
0   NM_001032091.1  CG33650-RA, transcript variant A (DNApol-gamma35), mRNA 
0   12  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   NM_140080.1  CG3335-RA (CG3335), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.