National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1102R-2 
 Symbol MP1  Full Name Melanization Protease 1 
 CG No CG1102  Old CG No CG1102 
 Synonyms CG1102, SP25, proPO-AE, BEST:GH02921, MP1 
 Accession No (Link to NCBI) NM_141193.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Goto S.
SpƤtzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.
Cell Struct Funct (2016) 41(1) 55-60 [ PubMed ID = 26843333 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCACCGTACTGTGGATGCTAT 
 Primer Seq. 3'
aatctagaggtaccCGTCAGAACGTAACGATGGTT 
 Predicted Fragment Size
491 
 IR fragment full Seq
0001 TCACCGTACT GTGGATGCTA TTGATGGGAA CAAGCAGCAC TTACGCACAA GAAATCTTTG 
0061 GGTATTGTAG AACGCCTGAT GAGAACAGCG GCACCTGCAT AAACCTCCGG GAATGTGGAT 
0121 ACCTATTCGA ACTGCTTCAA AGCGAAGAGG TTACGGNAAC AGGACCGTCG ATTTCTGCAA 
0181 GCCAGCCAAT GTGGCTACCG GAATGGACAA GTGCTTATTT GCTGTGCAAA CAGCCGNAAT 
0241 GCGAAACCAG CAACCTCAGT GGGGAAATCA TCCTCAACCT ACTCAGACCA CTAAGCCTAC 
0301 AAAACGCTCT GGGACCAAAC TGTTACCAAT GGCGCCCAAT TGCGGTGAAA ACTTTGGAGA 
0361 CCGAGTGGTG GGTGGTAACG AGACGACAAA GAGGGAGTTT CCTTGGATGG CCCTAATAGA 
0421 GTACACGAAG CCCGGTAACG TGAAAGGTCA CCACTGCGGC GGATCTCTAA TCAACCATCG 
0481 TTACGTTCTG ACG 
 in silico PCR Fragment
0001 TCACCGTACT GTGGATGCTA TTGATGGGAA CAAGCAGCAC TTACGCACAA GAAATCTTTG 
0061 GGTATTGTAG AACGCCTGAT GAGAACAGCG GCACCTGCAT AAACCTCCGG GAATGTGGAT 
0121 ACCTATTCGA ACTGCTTCAA AGCGAAGAGG TTACGG-AAC AGGACCGTCG ATTTCTGCAA 
0181 GCCAGCCAAT GTGGCTACCG GAATGGACAA GTGCTTATTT GCTGTGCAAA CAGCCG-AAT 
0241 GCGAAACCAG CAACCTCAGT GGGGAAATCA TCCTCAACCT ACTCAGACCA CTAAGCCTAC 
0301 AAAACGCTCT GGGACCAAAC TGTTACCAAT GGCGCCCAAT TGCGGTGAAA ACTTTGGAGA 
0361 CCGAGTGGTG GGTGGTAACG AGACGACAAA GAGGGAGTTT CCTTGGATGG CCCTAATAGA 
0421 GTACACGAAG CCCGGTAACG TGAAAGGTCA CCACTGCGGC GGATCTCTAA TCAACCATCG 
0481 TTACGTTCTG ACG 
 Assemble Data

1102R-2.IR_full       1   TCACCGTACTGTGGATGCTATTGATGGGAACAAGCAGCACTTACGCACAAGAAATCTTTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     1   TCACCGTACTGTGGATGCTATTGATGGGAACAAGCAGCACTTACGCACAAGAAATCTTTG 60


1102R-2.IR_full       61  GGTATTGTAGAACGCCTGATGAGAACAGCGGCACCTGCATAAACCTCCGGGAATGTGGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     61  GGTATTGTAGAACGCCTGATGAGAACAGCGGCACCTGCATAAACCTCCGGGAATGTGGAT 120


1102R-2.IR_full       121 ACCTATTCGAACTGCTTCAAAGCGAAGAGGTTACGGNAACAGGACCGTCGATTTCTGCAA 180
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1102R-2.in silico     121 ACCTATTCGAACTGCTTCAAAGCGAAGAGGTTACGG-AACAGGACCGTCGATTTCTGCAA 180


1102R-2.IR_full       181 GCCAGCCAATGTGGCTACCGGAATGGACAAGTGCTTATTTGCTGTGCAAACAGCCGNAAT 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
1102R-2.in silico     181 GCCAGCCAATGTGGCTACCGGAATGGACAAGTGCTTATTTGCTGTGCAAACAGCCG-AAT 240


1102R-2.IR_full       241 GCGAAACCAGCAACCTCAGTGGGGAAATCATCCTCAACCTACTCAGACCACTAAGCCTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     241 GCGAAACCAGCAACCTCAGTGGGGAAATCATCCTCAACCTACTCAGACCACTAAGCCTAC 300


1102R-2.IR_full       301 AAAACGCTCTGGGACCAAACTGTTACCAATGGCGCCCAATTGCGGTGAAAACTTTGGAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     301 AAAACGCTCTGGGACCAAACTGTTACCAATGGCGCCCAATTGCGGTGAAAACTTTGGAGA 360


1102R-2.IR_full       361 CCGAGTGGTGGGTGGTAACGAGACGACAAAGAGGGAGTTTCCTTGGATGGCCCTAATAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     361 CCGAGTGGTGGGTGGTAACGAGACGACAAAGAGGGAGTTTCCTTGGATGGCCCTAATAGA 420


1102R-2.IR_full       421 GTACACGAAGCCCGGTAACGTGAAAGGTCACCACTGCGGCGGATCTCTAATCAACCATCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1102R-2.in silico     421 GTACACGAAGCCCGGTAACGTGAAAGGTCACCACTGCGGCGGATCTCTAATCAACCATCG 480


1102R-2.IR_full       481 TTACGTTCTGACG 493
                          |||||||||||||
1102R-2.in silico     481 TTACGTTCTGACG 493

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   473  NM_141193.3  CG1102-RA (MP1), mRNA 
0.21   NM_205992.2  CG18636-RA (CG18636), mRNA 
0   NM_169192.2  CG3066-RC, transcript variant C (Sp7), mRNA 
0   NM_206457.1  CG3066-RD, transcript variant D (Sp7), mRNA 
0   NM_169193.1  CG3066-RB, transcript variant B (Sp7), mRNA 
0   NM_141477.2  CG3066-RA, transcript variant A (Sp7), mRNA 
0   16  NM_079638.2  CG4920-RA (ea), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_142910.2  CG16710-RA (CG16710), mRNA 
0   NM_001038971.1  CG34035-RA (CG34035), mRNA 
0   NM_135027.2  CG3008-RA (CG3008), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_132145.2  CG14430-RA (CG14430), mRNA 
0   NM_169853.1  CG3619-RB, transcript variant B (Dl), mRNA 
0   NM_057916.3  CG3619-RA, transcript variant A (Dl), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_142964.2  CG6178-RA (CG6178), mRNA 
0   NM_140989.1  CG13251-RA (CG13251), mRNA 
0   NM_142123.1  CG3505-RA (CG3505), mRNA 
0   NM_136612.2  CG8069-RA, transcript variant A (Phax), mRNA 
0   NM_165644.1  CG8069-RB, transcript variant B (Phax), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_143613.2  CG12063-RA (CG12063), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_169384.2  CG31386-RA (CG31386), mRNA 
0   NM_132070.1  CG3599-RA (CG3599), mRNA 
0   NM_001043131.1  CG33274-RB (CG33274), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.