National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10967R-1 
 Symbol Atg1  Full Name Autophagy-specific gene 1 
 CG No CG10967  Old CG No CG10967 
 Synonyms CG10967, ATG1, l(3)00305, UNC 51-like, anon-WO0118547.287, Atg1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  3 semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTCTACAAAGGACGTCATCG 
 Primer Seq. 3'
aatctagaggtaccTCACCTCGGGCGCCATATACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NCTCTACAAA GGACGTCATC GCAAGAAACA CATGCCGGTG GCATCAAGTG CATCACGAAG 
0061 AAGGGACAAC TGAAGACGCA GAATCTGCTC GGCAAGGAGA TCAAGATCCT GAAGGAGCTC 
0121 ACCGAGCTGC ACCATGAGAA TGTGGTGGCT CTGCTGGACT GCAAGGAGTC CCAGGATTGC 
0181 GTCAGCCTGN TCATGGAGTA TTGCAATGGC GGCGACTTGG CGGATTATCT GAGTGTCAAG 
0241 GGGACGCTCA GCGAGGATAC CGTTAGACTC TTCCTCGTGC AACTAGCTGG TGCTATGAAA 
0301 GCACTTTATA CCAAAGGAAT TGTGCATCGT GATCTCAAGC CACAAAACAT TNTGCTATCG 
0361 CACAATTATG GCAAAACATT GCCAGCTCCA TCGAAAATAA CCCTGAAAAT TGCGGATTTT 
0421 GGGTTTGCGC GATTCCTGAA CGAGGGCGCC ATGGCAGCCA CTCTGTGCGG CTCTCCCATG 
0481 TATATGGCGC CCGAGGTGA 
 in silico PCR Fragment
0001 CGTCTACAAA GGACGTCATC GCAAGAAACA CATGCCGGTG GCCATCAAGT GCATCACGAA 
0061 GAAGGGACAA CTGAAGACGC AGAATCTGCT CGGCAAGGAG ATCAAGATCC TGAAGGAGCT 
0121 CACCGAGCTG CACCATGAGA ATGTGGTGGC TCTGCTGGAC TGCAAGGAGT CCCAGGATTG 
0181 CGTCAGCCTG GTCATGGAGT ATTGCAATGG CGGCGACTTG GCGGATTATC TGAGTGTCAA 
0241 GGGGACGCTC AGCGAGGATA CCGTTAGACT CTTCCTCGTG CAACTAGCTG GTGCTATGAA 
0301 AGCACTTTAT ACCAAAGGAA TTGTGCATCG TGATCTCAAG CCACAAAACA TTTTGCTATC 
0361 GCACAATTAT GGCAAAACAT TGCCAGCTCC ATCGAAAATA ACCCTGAAAA TTGCGGATTT 
0421 TGGGTTTGCG CGATTCCTGA ACGAGGGCGC CATGGCAGCC ACTCTGTGCG GCTCTCCCAT 
0481 GTATATGGCG CCCGAGGTGA  
 Assemble Data

10967R-1.IR full        1   CTCTACAAAGGACGTCATCGCAAGAAACACATGCCGGTGGC-ATCAAGTGCATCACGAA 59
                             |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
10967R-1.in silico      1   GTCTACAAAGGACGTCATCGCAAGAAACACATGCCGGTGGCCATCAAGTGCATCACGAA 59


10967R-1.IR full       61  GAAGGGACAACTGAAGACGCAGAATCTGCTCGGCAAGGAGATCAAGATCCTGAAGGAGCT 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     61  GAAGGGACAACTGAAGACGCAGAATCTGCTCGGCAAGGAGATCAAGATCCTGAAGGAGCT 119


10967R-1.IR full       121 CACCGAGCTGCACCATGAGAATGTGGTGGCTCTGCTGGACTGCAAGGAGTCCCAGGATTG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     121 CACCGAGCTGCACCATGAGAATGTGGTGGCTCTGCTGGACTGCAAGGAGTCCCAGGATTG 179


10967R-1.IR full       181 CGTCAGCCTGNTCATGGAGTATTGCAATGGCGGCGACTTGGCGGATTATCTGAGTGTCAA 239
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     181 CGTCAGCCTGGTCATGGAGTATTGCAATGGCGGCGACTTGGCGGATTATCTGAGTGTCAA 239


10967R-1.IR full       241 GGGGACGCTCAGCGAGGATACCGTTAGACTCTTCCTCGTGCAACTAGCTGGTGCTATGAA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     241 GGGGACGCTCAGCGAGGATACCGTTAGACTCTTCCTCGTGCAACTAGCTGGTGCTATGAA 299


10967R-1.IR full       301 AGCACTTTATACCAAAGGAATTGTGCATCGTGATCTCAAGCCACAAAACATTNTGCTATC 359
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
10967R-1.in silico     301 AGCACTTTATACCAAAGGAATTGTGCATCGTGATCTCAAGCCACAAAACATTTTGCTATC 359


10967R-1.IR full       361 GCACAATTATGGCAAAACATTGCCAGCTCCATCGAAAATAACCCTGAAAATTGCGGATTT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     361 GCACAATTATGGCAAAACATTGCCAGCTCCATCGAAAATAACCCTGAAAATTGCGGATTT 419


10967R-1.IR full       421 TGGGTTTGCGCGATTCCTGAACGAGGGCGCCATGGCAGCCACTCTGTGCGGCTCTCCCAT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10967R-1.in silico     421 TGGGTTTGCGCGATTCCTGAACGAGGGCGCCATGGCAGCCACTCTGTGCGGCTCTCCCAT 479


10967R-1.IR full       481 GTATATGGCGCCCGAGGTGA 499
                           ||||||||||||||||||||
10967R-1.in silico     481 GTATATGGCGCCCGAGGTGA 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.