National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10954R-4 
 Symbol Arc-p34  Full Name Arc-p34 
 CG No CG10954  Old CG No CG10954 
 Synonyms ARPC2/p34, ARC-p34, Arpc2, p34, 38C.47, CG10954, ARC-P34, anon-WO0118547.154, Arc-p34 
 Accession No (Link to NCBI) NM_136189.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGATTATCGAGGAGACGCT 
 Primer Seq. 3'
aatctagaggtaccCATCGTCTTCGTCCCGGAAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGNATTATC GAGGAGACGC TGCTGGTCAA ATACCGTAAT GCCCAGGCTG GACTGAAGCC 
0061 TGAATCGATA GACATACGAA TAGCAGACTT CGACGGCGTG CTTTATCACA TTTCCAATGT 
0121 GAATGGCGAT AAAACAAAAG TTCGGATCAG CATATCGCTG AAGTTCTACA AACAGCTGCA 
0181 AGAACATGGA GCCGACGAGT TGCTGAAGCG TGAATATGGC AGTCTGCNTT ACAGACACGG 
0241 AAGAAGGCTA CAATGTTTCC GTACTTATCA ACCTGGAGGA GATTCCCGAG GACTGCGAGC 
0301 AAATCGCAAA GAGAATCGGA CTGCTGAAGC GCAACTGTTT CGCATCGGTT TTTGAAAAGT 
0361 ATTTTGACTA TCAGGAGCAG GGTGAAGAGG GCCAAAAGCG TGCCGTCATT AACTACCGCA 
0421 ACGATGAGAC TTTATATGTG GAAGCCAAGC CTGATCGTGT CACCGTCGTC TTTAGTACCA 
0481 TTTTCCGGGA CGAAGACGAT G 
 in silico PCR Fragment
0001 TCGGATTATC GAGGAGACGC TGCTGGTCAA ATACCGTAAT GCCCAGGCTG GACTGAAGCC 
0061 TGAATCGATA GACATACGAA TAGCAGACTT CGACGGCGTC CTTTATCACA TTTCCAATGT 
0121 GAATGGCGAT AAAACAAAAG TTCGGATCAG CATATCGCTG AAGTTCTACA AACAGCTGCA 
0181 AGAACATGGA GCCGACGAGT TGCTGAAGCG TGAATATGGC AGTCTGC-TT ACAGACACGG 
0241 AAGAAGGCTA CAATGTTTCC GTACTTATCA ACCTGGAGGA GATTCCCGAG GACTGCGAGC 
0301 AAATCGCAAA GAGAATCGGA CTGCTGAAGC GCAACTGTTT CGCATCGGTT TTTGAAAAGT 
0361 ATTTTGACTA TCAGGAGCAG GGCGAAGAGG GCCAAAAGCG TGCCGTCATT AACTACCGCA 
0421 ACGATGAGAC TTTATATGTG GAAGCCAAGC CTGATCGTGT CACCGTCGTC TTTAGTACCA 
0481 TTTTCCGGGA CGAAGACGAT G 
 Assemble Data

10954R-4.IR_full       1   TCGNATTATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGACTGAAGCC 60
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10954R-4.in silico     1   TCGGATTATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGACTGAAGCC 60


10954R-4.IR_full       61  TGAATCGATAGACATACGAATAGCAGACTTCGACGGCGTGCTTTATCACATTTCCAATGT 120
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
10954R-4.in silico     61  TGAATCGATAGACATACGAATAGCAGACTTCGACGGCGTCCTTTATCACATTTCCAATGT 120


10954R-4.IR_full       121 GAATGGCGATAAAACAAAAGTTCGGATCAGCATATCGCTGAAGTTCTACAAACAGCTGCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10954R-4.in silico     121 GAATGGCGATAAAACAAAAGTTCGGATCAGCATATCGCTGAAGTTCTACAAACAGCTGCA 180


10954R-4.IR_full       181 AGAACATGGAGCCGACGAGTTGCTGAAGCGTGAATATGGCAGTCTGCNTTACAGACACGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10954R-4.in silico     181 AGAACATGGAGCCGACGAGTTGCTGAAGCGTGAATATGGCAGTCTGC-TTACAGACACGG 240


10954R-4.IR_full       241 AAGAAGGCTACAATGTTTCCGTACTTATCAACCTGGAGGAGATTCCCGAGGACTGCGAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10954R-4.in silico     241 AAGAAGGCTACAATGTTTCCGTACTTATCAACCTGGAGGAGATTCCCGAGGACTGCGAGC 300


10954R-4.IR_full       301 AAATCGCAAAGAGAATCGGACTGCTGAAGCGCAACTGTTTCGCATCGGTTTTTGAAAAGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10954R-4.in silico     301 AAATCGCAAAGAGAATCGGACTGCTGAAGCGCAACTGTTTCGCATCGGTTTTTGAAAAGT 360


10954R-4.IR_full       361 ATTTTGACTATCAGGAGCAGGGTGAAGAGGGCCAAAAGCGTGCCGTCATTAACTACCGCA 420
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10954R-4.in silico     361 ATTTTGACTATCAGGAGCAGGGCGAAGAGGGCCAAAAGCGTGCCGTCATTAACTACCGCA 420


10954R-4.IR_full       421 ACGATGAGACTTTATATGTGGAAGCCAAGCCTGATCGTGTCACCGTCGTCTTTAGTACCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10954R-4.in silico     421 ACGATGAGACTTTATATGTGGAAGCCAAGCCTGATCGTGTCACCGTCGTCTTTAGTACCA 480


10954R-4.IR_full       481 TTTTCCGGGACGAAGACGATG 501
                           |||||||||||||||||||||
10954R-4.in silico     481 TTTTCCGGGACGAAGACGATG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136189.2  CG10954-RA (Arc-p34), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_136415.1  CG12835-RA (CG12835), mRNA 
0   NM_143408.2  CG1401-RA (cul-5), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_001031933.1  CG33232-RD, transcript variant D (CG33232), mRNA 
0   NM_206245.1  CG33232-RB, transcript variant B (CG33232), mRNA 
0   NM_206246.1  CG33232-RA, transcript variant A (CG33232), mRNA 
0   NM_206244.1  CG33232-RC, transcript variant C (CG33232), mRNA 
0   NM_164859.1  CG3838-RA, transcript variant A (CG3838), mRNA 
0   NM_135454.4  CG3838-RB, transcript variant B (CG3838), mRNA 
0   NM_001038756.1  CG33968-RA (CG33968), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_001038966.1  CG33967-RA (CG33967), mRNA 
0   NM_144126.1  CG17059-RA (CG17059), mRNA 
0   NM_138210.1  CG13894-RA (CG13894), mRNA 
0   NM_170636.1  CG3897-RD, transcript variant D (blot), mRNA 
0   NM_080079.2  CG32120-RA (sens), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_138225.2  CG13907-RA (CG13907), mRNA 
0   NM_165427.1  CG10392-RC, transcript variant C (Ogt), mRNA 
0   NM_165426.1  CG10392-RA, transcript variant A (Ogt), mRNA 
0   NM_168289.1  CG32022-RA (CG32022), mRNA 
0   NM_078896.2  CG10392-RB, transcript variant B (Ogt), mRNA 
0   NM_132038.1  CG4052-RA (CG4052), mRNA 
0   NM_142142.1  CG7292-RA (Rrp6), mRNA 
0   NM_132644.1  CG1622-RA (CG1622), mRNA 
0   NM_143403.2  CG11837-RA (CG11837), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.