National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10954R-1 
 Symbol Arc-p34  Full Name Arc-p34 
 CG No CG10954  Old CG No CG10954 
 Synonyms ARPC2/p34, ARC-p34, Arpc2, p34, 38C.47, CG10954, ARC-P34, anon-WO0118547.154, Arc-p34 
 Accession No (Link to NCBI) NM_136189.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGGATTATCGAGGAGACGCTGCTGGTCAAATACCGTAATGCCCAGGCTGGACTGAAGCC 60

                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     61  TGAATCGATAGACATACGAATAGCAGACTTCGACGGCGTCCTTTATCACATTTCCAATGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAATGGCGATAAAACAAAAGTTCGGATCAGCATATCGCTGAAGTTCTACAAACAGCTGCA 180

                           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     181 AGAACATGGAGCCGACGAGTTGCTGAAGCGTGAATATGGCAGTCTGC-TTACAGACACGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGAAGGCTACAATGTTTCCGTACTTATCAACCTGGAGGAGATTCCCGAGGACTGCGAGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAATCGCAAAGAGAATCGGACTGCTGAAGCGCAACTGTTTCGCATCGGTTTTTGAAAAGT 360

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     361 ATTTTGACTATCAGGAGCAGGGCGAAGAGGGCCAAAAGCGTGCCGTCATTAACTACCGCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGATGAGACTTTATATGTGGAAGCCAAGCCTGATCGTGTCACCGTCGTCTTTAGTACCA 480

10954R-1.IR_full       481 TTTTCCGGGACGAAGACGATG 501
                           ||||||||||||||||||||| silico     481 TTTTCCGGGACGAAGACGATG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136189.2  CG10954-RA (Arc-p34), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_136415.1  CG12835-RA (CG12835), mRNA 
0   NM_143408.2  CG1401-RA (cul-5), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_001031933.1  CG33232-RD, transcript variant D (CG33232), mRNA 
0   NM_206245.1  CG33232-RB, transcript variant B (CG33232), mRNA 
0   NM_206246.1  CG33232-RA, transcript variant A (CG33232), mRNA 
0   NM_206244.1  CG33232-RC, transcript variant C (CG33232), mRNA 
0   NM_164859.1  CG3838-RA, transcript variant A (CG3838), mRNA 
0   NM_135454.4  CG3838-RB, transcript variant B (CG3838), mRNA 
0   NM_001038756.1  CG33968-RA (CG33968), mRNA 
0   NM_057790.4  CG32848-RA (VAChT), mRNA 
0   NM_001038966.1  CG33967-RA (CG33967), mRNA 
0   NM_144126.1  CG17059-RA (CG17059), mRNA 
0   NM_138210.1  CG13894-RA (CG13894), mRNA 
0   NM_170636.1  CG3897-RD, transcript variant D (blot), mRNA 
0   NM_080079.2  CG32120-RA (sens), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_138225.2  CG13907-RA (CG13907), mRNA 
0   NM_165427.1  CG10392-RC, transcript variant C (Ogt), mRNA 
0   NM_165426.1  CG10392-RA, transcript variant A (Ogt), mRNA 
0   NM_168289.1  CG32022-RA (CG32022), mRNA 
0   NM_078896.2  CG10392-RB, transcript variant B (Ogt), mRNA 
0   NM_132038.1  CG4052-RA (CG4052), mRNA 
0   NM_142142.1  CG7292-RA (Rrp6), mRNA 
0   NM_132644.1  CG1622-RA (CG1622), mRNA 
0   NM_143403.2  CG11837-RA (CG11837), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.