National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10920R-2 
 Symbol CG10920  Full Name CG10920 
 CG No CG10920  Old CG No CG10920 
 Synonyms CG10920 
 Accession No (Link to NCBI) NM_132180.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGGGGCGATGGTTGTGGAA 
 Primer Seq. 3'
aatctagaggtaccCCCTCCTTGGGGCCTCTCTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTGGGGCGA TGGTTGTGGA ACTGGCAGTG GACCCTTCCC GTGCGATGAG GTCGACCAAC 
0061 CAGCAGCAGC CAATTGATCG GGATCAGTTG AGGATCAGCA CGGAGGAAAG CTGTCAGGGA 
0121 TCCGAGTTGG TTGTCGCATC ATCACATCTA TCCAAAAAAA TTCAAGAACA TCGCCGACCA 
0181 AATCAGCTGG TGCGCTTTTG CCTACGATTG GGCTACAACA CCCTGCTGTA TCCGTACGAA 
0241 ATGGCCAAGG TTCTTATCCA ACTGGGACAT GAACCGCTTC AGGCGAAGCC CTTTGTTATG 
0301 CGACTGATTN CAACGGCGGC CACGCCTCTT TTTGCCCAGT GTCCATCGGT ATGTGCAGCA 
0361 CATTCAGCAT ATAGATGGCT ATACGGGAAT GTATCGTGGG TTGACCGCTC GCCTGGCCGC 
0421 CAGCATAGTA GACTATTTGC TTGGCGATCT TCTGCTGGCT ACCTTGCACT TTGCACCCTA 
0481 TAAGAGAGGc CCCAAGGAGG G 
 in silico PCR Fragment
0001 TCTGGGGCGA TGGTTGTGGA ACTGGCAGTG GACCCTTCCC GAGCGATGAG GTCGACCAAC 
0061 CAGCAGCAGC CAATTGATCG GGATCAGTTG AGGATCAGCA CGGAGGAAAG CTGTCAGGGA 
0121 TCCGAGTTGG TTGTCGCATC ATCACATCTA TCCAAAAAAA TTCAAGAACA TCGCCGACCA 
0181 AATCAGCTGG TGCGCTTTTG CCTACGATTG GGCTACAACA CCCTGCTGTA TCCGTACGAA 
0241 ATGGCCAAGG TTCTTATCCA ACTGGGACAT GAACCGCTTC AGGCGAAGCC CTTTGTTATG 
0301 CGACTGATT- CAACGGCGGC CACGCCTCTT TTTGCCCAGT GTCCATCGGT ATGTGCAGCA 
0361 CATTCAGCAT ATAGATGGCT ATACGGGAAT GTATCGTGGG TTGACCGCTC GCCTGGCCGC 
0421 CAGCATAGTA GACTATTTGC TTGGCGATCT TCTGCTGGCT ACCTTGCACT TTGCACCCTA 
0481 TAAGAGAGGC CCCAAGGAGG G 
 Assemble Data

10920R-2.IR_full       1   TCTGGGGCGATGGTTGTGGAACTGGCAGTGGACCCTTCCCGTGCGATGAGGTCGACCAAC 60
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
10920R-2.in silico     1   TCTGGGGCGATGGTTGTGGAACTGGCAGTGGACCCTTCCCGAGCGATGAGGTCGACCAAC 60


10920R-2.IR_full       61  CAGCAGCAGCCAATTGATCGGGATCAGTTGAGGATCAGCACGGAGGAAAGCTGTCAGGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     61  CAGCAGCAGCCAATTGATCGGGATCAGTTGAGGATCAGCACGGAGGAAAGCTGTCAGGGA 120


10920R-2.IR_full       121 TCCGAGTTGGTTGTCGCATCATCACATCTATCCAAAAAAATTCAAGAACATCGCCGACCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     121 TCCGAGTTGGTTGTCGCATCATCACATCTATCCAAAAAAATTCAAGAACATCGCCGACCA 180


10920R-2.IR_full       181 AATCAGCTGGTGCGCTTTTGCCTACGATTGGGCTACAACACCCTGCTGTATCCGTACGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     181 AATCAGCTGGTGCGCTTTTGCCTACGATTGGGCTACAACACCCTGCTGTATCCGTACGAA 240


10920R-2.IR_full       241 ATGGCCAAGGTTCTTATCCAACTGGGACATGAACCGCTTCAGGCGAAGCCCTTTGTTATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     241 ATGGCCAAGGTTCTTATCCAACTGGGACATGAACCGCTTCAGGCGAAGCCCTTTGTTATG 300


10920R-2.IR_full       301 CGACTGATTNCAACGGCGGCCACGCCTCTTTTTGCCCAGTGTCCATCGGTATGTGCAGCA 360
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     301 CGACTGATT-CAACGGCGGCCACGCCTCTTTTTGCCCAGTGTCCATCGGTATGTGCAGCA 360


10920R-2.IR_full       361 CATTCAGCATATAGATGGCTATACGGGAATGTATCGTGGGTTGACCGCTCGCCTGGCCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     361 CATTCAGCATATAGATGGCTATACGGGAATGTATCGTGGGTTGACCGCTCGCCTGGCCGC 420


10920R-2.IR_full       421 CAGCATAGTAGACTATTTGCTTGGCGATCTTCTGCTGGCTACCTTGCACTTTGCACCCTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10920R-2.in silico     421 CAGCATAGTAGACTATTTGCTTGGCGATCTTCTGCTGGCTACCTTGCACTTTGCACCCTA 480


10920R-2.IR_full       481 TAAGAGAGGCCCCAAGGAGGG 501
                           |||||||||||||||||||||
10920R-2.in silico     481 TAAGAGAGGCCCCAAGGAGGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132180.1  CG10920-RA (CG10920), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_078698.2  CG1676-RA (cactin), mRNA 
0   NM_176193.1  CG8440-RE, transcript variant E (Lis-1), mRNA 
0   NM_206130.1  CG8440-RF, transcript variant F (Lis-1), mRNA 
0   NM_138016.2  CG10904-RA (CG10904), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_141499.2  CG2698-RA (CG2698), mRNA 
0   NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NR_002020.1  CR32865, miscRNA 
0   NM_078600.2  CG10521-RA (NetB), mRNA 
0   NM_168090.1  CG32242-RA (CG32242), mRNA 
0   NM_138985.2  CG8947-RA (26-29-p), mRNA 
0   NM_168297.1  CG32026-RA (CG32026), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_168084.1  CG11347-RD, transcript variant D (CG11347), mRNA 
0   NM_168083.1  CG11347-RB, transcript variant B (CG11347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.