National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1090R-2 
 Symbol CG1090  Full Name CG1090 
 CG No CG1090  Old CG No CG1090 
 Synonyms CG1090 
 Accession No (Link to NCBI) NM_141202.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCGCCAAAGGAGACACCAA 
 Primer Seq. 3'
aatctagaggtaccTGCCGATGTCGTCCTTAGCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCGCCAAA GGAGACACCA AGGACGGACA GGTCCTGCCT CTGGATGTGG GCGCTCTGGC 
0061 CGAGGACGCT GGCGATGcCG AGGCCAACGG AGAGGATACT CCAGAGAGAA ACTCAGAGAG 
0121 TTCCGTTCTG GACACAACAC TGGCGTTTGA GcCTCAGGCG AGTACACAAT CGACTCCCAT 
0181 TCATGGCGCG GTTCCCACCT GGCGCCCAAA GCGGGACAAC TGCACGcCCC CGGCTATCGA 
0241 GCAGTTTCCA CAGCCGCTGA TGAATAAGTG GGCGCGACAG cACGGCGGCC TTATCCTCCA 
0301 CATACTGGTG GCAGTCTTCA CTTTCTTCGG GTTGGCAATA GTTTGCGATG AGTACTTTGT 
0361 GGCCAGTCTG GATCGGCTTT GCGAGGAGCT AAAGCTATCG CCAGATGTTG CGGGAGCCAC 
0421 GTTTATGGCT GCCGGAAGCT CGGCTCCTGA ACTGGCCACT GTGGTGATAG GAGTGTTCTT 
0481 TGCTAAGGAC CACATCGGCA  
 in silico PCR Fragment
0001 CTCCGCCAAA GGAGACACCA AGGACGGACA GGTCCTGCCT CTGGATGTGG GCGCTCTGGC 
0061 CGAGGACGCT GGCGATGCCG AGGCCAACGG AGAGGATACT CCAGAGAGAA ACTCAGAGAG 
0121 TTCCGTTCTG GACACAACAC TGGCGTTTGA GCCTCAGGCG AGTACACAAT CGACTCCCAT 
0181 TCATGGCGCG GTTCCCACCT GGCGCCCAAA GCGGGACAAC TGCACGCCCC CGGCTATCGA 
0241 GCAGTTTCCA CAGCCGCTGA TGAATAAGTG GGCGCGACAG CACGGCGGCC TTATCCTCCA 
0301 CATACTGGTG GCAGTCTTCA CTTTCTTCGG GTTGGCAATA GTTTGCGATG AGTACTTTGT 
0361 GGCCAGTCTG GATCGGCTTT GCGAGGAGCT AAAGCTATCG CCAGATGTTG CGGGAGCCAC 
0421 GTTTATGGCT GCCGGAAGCT CGGCTCCTGA ACTGGCCACT GTGGTGATAG GAGTGTTCTT 
0481 TGCTAAGGAC GACATCGGCA  
 Assemble Data

1090R-2.IR_full       1   CTCCGCCAAAGGAGACACCAAGGACGGACAGGTCCTGCCTCTGGATGTGGGCGCTCTGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     1   CTCCGCCAAAGGAGACACCAAGGACGGACAGGTCCTGCCTCTGGATGTGGGCGCTCTGGC 60


1090R-2.IR_full       61  CGAGGACGCTGGCGATGCCGAGGCCAACGGAGAGGATACTCCAGAGAGAAACTCAGAGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     61  CGAGGACGCTGGCGATGCCGAGGCCAACGGAGAGGATACTCCAGAGAGAAACTCAGAGAG 120


1090R-2.IR_full       121 TTCCGTTCTGGACACAACACTGGCGTTTGAGCCTCAGGCGAGTACACAATCGACTCCCAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     121 TTCCGTTCTGGACACAACACTGGCGTTTGAGCCTCAGGCGAGTACACAATCGACTCCCAT 180


1090R-2.IR_full       181 TCATGGCGCGGTTCCCACCTGGCGCCCAAAGCGGGACAACTGCACGCCCCCGGCTATCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     181 TCATGGCGCGGTTCCCACCTGGCGCCCAAAGCGGGACAACTGCACGCCCCCGGCTATCGA 240


1090R-2.IR_full       241 GCAGTTTCCACAGCCGCTGATGAATAAGTGGGCGCGACAGCACGGCGGCCTTATCCTCCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     241 GCAGTTTCCACAGCCGCTGATGAATAAGTGGGCGCGACAGCACGGCGGCCTTATCCTCCA 300


1090R-2.IR_full       301 CATACTGGTGGCAGTCTTCACTTTCTTCGGGTTGGCAATAGTTTGCGATGAGTACTTTGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     301 CATACTGGTGGCAGTCTTCACTTTCTTCGGGTTGGCAATAGTTTGCGATGAGTACTTTGT 360


1090R-2.IR_full       361 GGCCAGTCTGGATCGGCTTTGCGAGGAGCTAAAGCTATCGCCAGATGTTGCGGGAGCCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     361 GGCCAGTCTGGATCGGCTTTGCGAGGAGCTAAAGCTATCGCCAGATGTTGCGGGAGCCAC 420


1090R-2.IR_full       421 GTTTATGGCTGCCGGAAGCTCGGCTCCTGAACTGGCCACTGTGGTGATAGGAGTGTTCTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1090R-2.in silico     421 GTTTATGGCTGCCGGAAGCTCGGCTCCTGAACTGGCCACTGTGGTGATAGGAGTGTTCTT 480


1090R-2.IR_full       481 TGCTAAGGACCACATCGGCA 500
                          |||||||||| |||||||||
1090R-2.in silico     481 TGCTAAGGACGACATCGGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141202.2  CG1090-RB, transcript variant B (CG1090), mRNA 
96.47   465  NM_164343.1  CG1090-RA, transcript variant A (CG1090), mRNA 
0.2   NM_130616.2  CG4290-RA (CG4290), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   10  NM_140588.1  CG13073-RB, transcript variant B (CG13073), mRNA 
0   NM_168654.1  CG13073-RA, transcript variant A (CG13073), mRNA 
0   NM_134761.2  CG10869-RA (CG10869), mRNA 
0   NM_079544.3  CG2505-RA (alpha-Est2), mRNA 
0   NM_141673.4  CG31352-RA (CG31352), mRNA 
0   NM_169301.2  CG31332-RC, transcript variant C (unc-115), mRNA 
0   NM_169300.2  CG31332-RD, transcript variant D (unc-115), mRNA 
0   NM_169303.2  CG31332-RB, transcript variant B (unc-115), mRNA 
0   NM_169302.1  CG31332-RA, transcript variant A (unc-115), mRNA 
0   NM_140003.1  CG13312-RA (CG13312), mRNA 
0   NM_137897.2  CG3831-RA (CG3831), mRNA 
0   NM_144467.1  CG3267-RA (CG3267), mRNA 
0   NM_166976.1  CG32791-RA (CG32791), mRNA 
0   NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   NM_001015262.1  CG2893-PA.3 (CG2893), mRNA 
0   NM_001015263.1  CG2893-PD.3 (CG2893), mRNA 
0   NM_001015261.1  CG2893-PC.3 (CG2893), mRNA 
0   NM_001015260.1  CG2893-PB.3 (CG2893), mRNA 
0   NM_001015091.1  CG40269-PA.3 (CG40269), mRNA 
0   NM_132685.1  CG9940-RA, transcript variant A (CG9940), mRNA 
0   NM_167378.1  CG9940-RB, transcript variant B (CG9940), mRNA 
0   NM_136576.2  CG8252-RA (CG8252), mRNA 
0   NM_165933.1  CG8632-RB, transcript variant B (CG8632), mRNA 
0   NM_136962.2  CG8632-RA, transcript variant A (CG8632), mRNA 
0   10  NM_168179.1  CG32394-RA (CG32394), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.