National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10882R-1 
 Symbol CG10882  Full Name CG10882 
 CG No CG10882  Old CG No CG10882 
 Synonyms BcDNA:LP05220, CG10882 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCACGCAGTTCCAGCAGCAA 
 Primer Seq. 3'
aatctagaggtaccGCCAAAGTGGCGCTGTTCAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10882R-1.IR full       1   CCCANNNCAGTTCCAGCAGCAACCCCAGTTTGGG-CTCCTCCTCCGAATTCCGGAGGTTG 60
                            ||    ||||||||||||||||||||||||||| |||||||||||||||||||||||||
10882R-1.in silico     1   -CCCACGCAGTTCCAGCAGCAACCCCAGTTTGGGGCTCCTCCTCCGAATTCCGGAGGTTG 60


10882R-1.IR full       61  GCCACCGCAGCAACAACAACTACCGCAGCAGCAGCCGSCGCAGCAACAACTGCCTCCGCA 120
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
10882R-1.in silico     61  GCCACCGCAGCAACAACAACTACCGCAGCAGCAGCCGCCGCAGCAACAACTGCCTCCGCA 120


10882R-1.IR full       121 GCAGCAGCAACAACAACCACAGTACGGAGCACCACCACCAACGTCGGCGGCATCCCAGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico     121 GCAGCAGCAACAACAACCACAGTACGGAGCACCACCACCAACGTCGGCGGCATCCCAGCC 180


10882R-1.IR full       181 TTACCTCAATGGCAACTACCAGCAGCAGTTGGCCACGTCGATGGGAGGTTTGAGTGTGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico     181 TTACCTCAATGGCAACTACCAGCAGCAGTTGGCCACGTCGATGGGAGGTTTGAGTGTGGG 240


10882R-1.IR full       241 TGGCGGTGTCGGTGGGGCCAATCCCCTGAAGCCACCACTCCCCCAAGGAGCTCCCGCTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico     241 TGGCGGTGTCGGTGGGGCCAATCCCCTGAAGCCACCACTCCCCCAAGGAGCTCCCGCTGC 300


10882R-1.IR full       301 TN-GGCACCACCGCCAACCGGTTTCAATCAGTTTAACTCTAATGCAGCACCTCCTCCGAC 360
                           |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico     301 TGCGGCACCACCGCCAACCGGTTTCAATCAGTTTAACTCTAATGCAGCACCTCCTCCGAC 360


10882R-1.IR full        361 AACAACAACAATGCTGCATTCGGTGCTCCACCACCGACGCAAGCTGGAAGTTATGTCAA 419
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico      361 AACAACAACAATGCTGCATTCGGTGCTCCACCACCGACGCAAGCTGGAAGTTATGTCAA 419


10882R-1.IR full       421 CGGAGCCCTACCGCCCAGCAGTACTCCACAAAGCGTGGCCAGTGGGATTAATCAGATGAG 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10882R-1.in silico     421 CGGAGCCCTACCGCCCAGCAGTACTCCACAAAGCGTGGCCAGTGGGATTAATCAGATGAG 479


10882R-1.IR full       481 CTTGAACAGCNNCNTTTTGGN 500
                           ||||||||||  |  ||||| 
10882R-1.in silico     481 CTTGAACAGCGCCACTTTGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.