National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10868R-5 
 Symbol orb  Full Name oo18 RNA-binding protein 
 CG No CG10868  Old CG No CG10868 
 Synonyms 151666_s_at, Orb, ORB, oo18, fs(3)00107, CG10868, orb 
 Accession No (Link to NCBI) NM_079736.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Pai TP, Chen CC, Lin HH, Chin AL, Lai JS, Lee PT, Tully T, Chiang AS.
Drosophila ORB protein in two mushroom body output neurons is necessary for long-term memory formation.
Proc. Natl. Acad. Sci. U.S.A. (2013) 110(19) 7898-903 [ PubMed ID = 23610406 ] [ RRC reference ]

Wu JK, Tai CY, Feng KL, Chen SL, Chen CC, Chiang AS.
Long-term memory requires sequential protein synthesis in three subsets of mushroom body output neurons in Drosophila.
Sci Rep (2017) 7(1) 7112 [ PubMed ID = 28769066 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACCCCCGATTGCTCCGGTT 
 Primer Seq. 3'
aatctagaggtaccTGGGTTAGCCGCTGAGGTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACACCCCCGA TTGCTCCGGT TCTGGTGGCA ACATGCGAGC CCTGAGCGGT AGGCTCCACA 
0061 ACGGAGTTGC TGCAGAAACA CTCGATAAGC TCCTACCTGG ATCACCACCA TCAGCAGCAG 
0121 CAGCAACAGC AGCATCACTT GCAACTGCAG TAACACCAAC AGCAGCACAG TCTGTTGGAG 
0181 AGATGCAACG ACGATGGATT GATATCTTTT ATAAACGATC CAATCACACT GAACGATCTA 
0241 CTCGGCTTGT GCGGTGCCAG CACTGCCAAT GAAGTGGTCG GTACTGGCCA GACCCCCTCG 
0301 ACATCAGCGC CGATACTTGG AGCAGGAGGA GGCGGAAGAG CAAATGGAGT TACAGCCGGC 
0361 GCAGCAACGG CAACAGGAGT GGGAGTTGGA GCTGGAGGGA CATTACCTGG GCCAGGAGTT 
0421 CCATCGATCC AGGGAGGTGG TGGAGGAGGA GTCGTGGGAC AACAAACCAA TGCCTCGTGC 
0481 AACACCTCAG CGGCTAACCC A 
 in silico PCR Fragment
0001 ACACCCCCGA TTGCTCCGGT TCTGGTGGCA ACATGCGAGC CCTGAGCGG- AGGCTCCACA 
0061 ACGGAGTTGC TGCAGAAACA CTCGATAAGC TCCTACCTGG ATCACCACCA TCAGCAGCAG 
0121 CAGCAACAGC AGCATCACTT GCAACTGCAG CAACACCAAC AGCAGCACAG TCTGTTGGAG 
0181 AGATGCAACG ACGATGGATT GATATCTTTT ATAAACGATC CAATCACACT GAACGATCTA 
0241 CTCGGCTTGT GCGGTGCCAG CACTGCCAAT GAAGTGGTCG GTACTGGCCA GACCCCCTCG 
0301 ACATCAGCGC CGATACTTGG AGCAGGAGGA GGCGGAAGAG CAAATGGAGT TACAGCCGGC 
0361 GCAGCAACGG CAACAGGAGT GGGAGTTGGA GCTGGAGGGA CATTACCTGG GCCAGGAGTT 
0421 CCATCGATCC AGGGAGGTGG TGGAGGAGGA GTCGTGGGAC AACAAACCAA TGCCTCGTGC 
0481 AACACCTCAG CGGCTAACCC A 
 Assemble Data

10868R-5.IR_full       1   ACACCCCCGATTGCTCCGGTTCTGGTGGCAACATGCGAGCCCTGAGCGGTAGGCTCCACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
10868R-5.in silico     1   ACACCCCCGATTGCTCCGGTTCTGGTGGCAACATGCGAGCCCTGAGCGG-AGGCTCCACA 60


10868R-5.IR_full       61  ACGGAGTTGCTGCAGAAACACTCGATAAGCTCCTACCTGGATCACCACCATCAGCAGCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     61  ACGGAGTTGCTGCAGAAACACTCGATAAGCTCCTACCTGGATCACCACCATCAGCAGCAG 120


10868R-5.IR_full       121 CAGCAACAGCAGCATCACTTGCAACTGCAGTAACACCAACAGCAGCACAGTCTGTTGGAG 180
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
10868R-5.in silico     121 CAGCAACAGCAGCATCACTTGCAACTGCAGCAACACCAACAGCAGCACAGTCTGTTGGAG 180


10868R-5.IR_full       181 AGATGCAACGACGATGGATTGATATCTTTTATAAACGATCCAATCACACTGAACGATCTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     181 AGATGCAACGACGATGGATTGATATCTTTTATAAACGATCCAATCACACTGAACGATCTA 240


10868R-5.IR_full       241 CTCGGCTTGTGCGGTGCCAGCACTGCCAATGAAGTGGTCGGTACTGGCCAGACCCCCTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     241 CTCGGCTTGTGCGGTGCCAGCACTGCCAATGAAGTGGTCGGTACTGGCCAGACCCCCTCG 300


10868R-5.IR_full       301 ACATCAGCGCCGATACTTGGAGCAGGAGGAGGCGGAAGAGCAAATGGAGTTACAGCCGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     301 ACATCAGCGCCGATACTTGGAGCAGGAGGAGGCGGAAGAGCAAATGGAGTTACAGCCGGC 360


10868R-5.IR_full       361 GCAGCAACGGCAACAGGAGTGGGAGTTGGAGCTGGAGGGACATTACCTGGGCCAGGAGTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     361 GCAGCAACGGCAACAGGAGTGGGAGTTGGAGCTGGAGGGACATTACCTGGGCCAGGAGTT 420


10868R-5.IR_full       421 CCATCGATCCAGGGAGGTGGTGGAGGAGGAGTCGTGGGACAACAAACCAATGCCTCGTGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10868R-5.in silico     421 CCATCGATCCAGGGAGGTGGTGGAGGAGGAGTCGTGGGACAACAAACCAATGCCTCGTGC 480


10868R-5.IR_full       481 AACACCTCAGCGGCTAACCCA 501
                           |||||||||||||||||||||
10868R-5.in silico     481 AACACCTCAGCGGCTAACCCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  59  175  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
55.18   266  46  125  NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
55.18   266  46  125  NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
6.22   30  372  1106  2103  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
6.22   30  372  1106  2103  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
6.22   30  372  1106  2103  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
4.14   20  47  159  442  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
3.31   16  76  283  727  NM_079903.2  CG15319-RB (nej), mRNA 
3.31   16  20  108  325  NM_176542.1  CG7029-RA (CG7029), mRNA 
3.11   15  93  284  693  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
3.11   15  40  138  371  NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
3.11   15  40  138  371  NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
2.9   14  51  151  388  NM_132004.2  CG4136-RA (CG4136), mRNA 
2.9   14  45  211  669  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
2.9   14  45  211  666  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
2.9   14  45  136  320  NM_132126.1  CG3075-RA (CG3075), mRNA 
2.69   13  42  145  458  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
2.48   12  58  240  503  NM_167000.1  CG32778-RA (CG32778), mRNA 
2.28   11  84  247  565  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
2.28   11  41  199  400  NM_078514.2  CG9653-RA (brk), mRNA 
2.28   11  34  130  200  NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
2.28   11  34  130  200  NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
2.28   11  32  113  246  NM_057511.3  CG3936-RA (N), mRNA 
2.28   11  31  113  452  NM_132525.1  CG15740-RA (CG15740), mRNA 
2.28   11  29  116  308  NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
2.28   11  25  128  344  NM_132412.1  CG9817-RA (CG9817), mRNA 
2.07   10  72  226  459  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
2.07   10  72  226  459  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
2.07   10  72  226  459  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
2.07   10  57  312  701  NM_139493.2  CG2083-RA (CG2083), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.