National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10814R-4 
 Symbol CG10814  Full Name CG10814 
 CG No CG10814  Old CG No CG10814 
 Synonyms CG10814 
 Accession No (Link to NCBI) NM_137024.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Laranjeira A, Schulz J, Dotti CG.
Genes Related to Fatty Acid β-Oxidation Play a Role in the Functional Decline of the Drosophila Brain with Age.
PLoS ONE (2016) 11(8) e0161143 [ PubMed ID = 27518101 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGAGATTTGCCCAGCCAAC 
 Primer Seq. 3'
aatctagaggtaccGGCTTCCTTGACCATGGCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gcCGATGGAT TTGCCCAGCC AACCGCTTAA GTTGGCTCTG CCAAAGGAGC AGGATCAGTC 
0061 GCGCCTGGTT CAGGTTCCCG ATCCTGATCG TCGGGACATG CAGTTTCCAG ACATTTGGCT 
0121 GCGCGATAAT TGCCGCTGCG AGGAGTGTTA TCTGCCACAG ACACTGAGTA GATTGCCCCA 
0181 GCTGTGGAAC CATCTGGACA CCAGTGTGCG GGTCCTGCGG CAGAGCGTGG ACGTGGACCA 
0241 GAGGGTCCTG TGTATAGAGT GGTCCGATGG ACATACCTCC CAGTATCCGT TCAGTTGGCT 
0301 GAGGGAGCGG GACTTCTCAT ACGCGAATCG CCAGCGTTAC CTGCGTGACT TTTACCGCCC 
0361 GGAGCAGAAG TTGTGGAGCG GTCTGGACTT TGAGAAAATC CGTCAGGTGT TCTACTACCA 
0421 AGAACTGCTC GATTGCGATT CgGCGTTGCA GCAATGGCTC CAGCATCTGG CAGTTTACGG 
0481 AGTGGCCATG GTCAAGGAAN NC 
 in silico PCR Fragment
0001 GCCGA--GAT TTGCCCAGCC AACCGCTTAA GTTGGCTCTG CCAAAGGAGC AGGATCAGTC 
0061 GCGCCTGGTT CAGGTTCCCG ATCCTGATCG TCGGGACATG CAGTTTCCAG ACATTTGGCT 
0121 GCGCGATAAT TGCCGCTGCG AGGAGTGCTA TCTGCCACAG ACACTGAGTA GATTGCCCCA 
0181 GCTGTGGAAC CATCTGGACA CCAGTGTGCG GGTCCTGCGG CAGAGCGTGG ACGTGGACCA 
0241 GAGGGTCCTG TGTATAGAGT GGTCCGATGG ACATACCTCC CAGTATCCGT TCAGTTGGCT 
0301 GAGGGAGCGG GACTTCTCAT ACGCGAATCG CCAGCGTTAC CTGCGTGACT TTTACCGCCC 
0361 GGAGCAGAAG TTGTGGAGCG GTCTGGACTT TGAGAAAATC CGTCAGGTGT TCTACTACCA 
0421 AGAACTGCTC GATTGCGATT CGGCGTTGCA GCAATGGCTC CAGCATCTGG CAGTTTACGG 
0481 AGTGGCCATG GTCAAGGAAG CC 
 Assemble Data

10814R-4.IR_full       1   GCCGATGGATTTGCCCAGCCAACCGCTTAAGTTGGCTCTGCCAAAGGAGCAGGATCAGTC 60
                           |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     1   GCCGA--GATTTGCCCAGCCAACCGCTTAAGTTGGCTCTGCCAAAGGAGCAGGATCAGTC 60


10814R-4.IR_full       61  GCGCCTGGTTCAGGTTCCCGATCCTGATCGTCGGGACATGCAGTTTCCAGACATTTGGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     61  GCGCCTGGTTCAGGTTCCCGATCCTGATCGTCGGGACATGCAGTTTCCAGACATTTGGCT 120


10814R-4.IR_full       121 GCGCGATAATTGCCGCTGCGAGGAGTGTTATCTGCCACAGACACTGAGTAGATTGCCCCA 180
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10814R-4.in silico     121 GCGCGATAATTGCCGCTGCGAGGAGTGCTATCTGCCACAGACACTGAGTAGATTGCCCCA 180


10814R-4.IR_full       181 GCTGTGGAACCATCTGGACACCAGTGTGCGGGTCCTGCGGCAGAGCGTGGACGTGGACCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     181 GCTGTGGAACCATCTGGACACCAGTGTGCGGGTCCTGCGGCAGAGCGTGGACGTGGACCA 240


10814R-4.IR_full       241 GAGGGTCCTGTGTATAGAGTGGTCCGATGGACATACCTCCCAGTATCCGTTCAGTTGGCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     241 GAGGGTCCTGTGTATAGAGTGGTCCGATGGACATACCTCCCAGTATCCGTTCAGTTGGCT 300


10814R-4.IR_full       301 GAGGGAGCGGGACTTCTCATACGCGAATCGCCAGCGTTACCTGCGTGACTTTTACCGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     301 GAGGGAGCGGGACTTCTCATACGCGAATCGCCAGCGTTACCTGCGTGACTTTTACCGCCC 360


10814R-4.IR_full       361 GGAGCAGAAGTTGTGGAGCGGTCTGGACTTTGAGAAAATCCGTCAGGTGTTCTACTACCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     361 GGAGCAGAAGTTGTGGAGCGGTCTGGACTTTGAGAAAATCCGTCAGGTGTTCTACTACCA 420


10814R-4.IR_full       421 AGAACTGCTCGATTGCGATTCGGCGTTGCAGCAATGGCTCCAGCATCTGGCAGTTTACGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10814R-4.in silico     421 AGAACTGCTCGATTGCGATTCGGCGTTGCAGCAATGGCTCCAGCATCTGGCAGTTTACGG 480


10814R-4.IR_full       481 AGTGGCCATGGTCAAGGAANNC 502
                           |||||||||||||||||||  |
10814R-4.in silico     481 AGTGGCCATGGTCAAGGAAGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137024.2  CG10814-RA (CG10814), mRNA 
0   NM_132113.2  CG3184-RA (CG3184), mRNA 
0   NM_130479.2  CG13377-RA (CG13377), mRNA 
0   NM_132539.2  CG1559-RA (Upf1), mRNA 
0   NM_176358.1  CG9614-RL, transcript variant L (pip), mRNA 
0   NM_176357.1  CG9614-RE, transcript variant E (pip), mRNA 
0   NM_057982.3  CG2819-RA (Pph13), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
0   NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
0   NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
0   NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
0   NM_167687.1  CG11943-RB, transcript variant B (CG11943), mRNA 
0   NM_134518.2  CG11943-RA, transcript variant A (CG11943), mRNA 
0   NM_080305.2  CG10755-RA (Cyp4ae1), mRNA 
0   NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_176293.1  CG33171-RC, transcript variant C (CG33171), mRNA 
0   NM_176294.2  CG33171-RE, transcript variant E (CG33171), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_135997.1  CG18563-RA (CG18563), mRNA 
0   NM_139994.1  CG6486-RA (CG6486), mRNA 
0   NM_079480.2  CG7619-RA (Pros54), mRNA 
0   NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
0   NM_143242.2  CG6420-RA (CG6420), mRNA 
0   NM_132739.1  CG5321-RA (CG5321), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.