National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10814R-2 
 Symbol CG10814  Full Name CG10814 
 CG No CG10814  Old CG No CG10814 
 Synonyms CG10814 
 Accession No (Link to NCBI) NM_137024.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Laranjeira A, Schulz J, Dotti CG.
Genes Related to Fatty Acid β-Oxidation Play a Role in the Functional Decline of the Drosophila Brain with Age.
PLoS ONE (2016) 11(8) e0161143 [ PubMed ID = 27518101 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCGA--GATTTGCCCAGCCAACCGCTTAAGTTGGCTCTGCCAAAGGAGCAGGATCAGTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGCCTGGTTCAGGTTCCCGATCCTGATCGTCGGGACATGCAGTTTCCAGACATTTGGCT 120

                           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     121 GCGCGATAATTGCCGCTGCGAGGAGTGCTATCTGCCACAGACACTGAGTAGATTGCCCCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGTGGAACCATCTGGACACCAGTGTGCGGGTCCTGCGGCAGAGCGTGGACGTGGACCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGGGTCCTGTGTATAGAGTGGTCCGATGGACATACCTCCCAGTATCCGTTCAGTTGGCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAGGGAGCGGGACTTCTCATACGCGAATCGCCAGCGTTACCTGCGTGACTTTTACCGCCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGAGCAGAAGTTGTGGAGCGGTCTGGACTTTGAGAAAATCCGTCAGGTGTTCTACTACCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGAACTGCTCGATTGCGATTCGGCGTTGCAGCAATGGCTCCAGCATCTGGCAGTTTACGG 480

10814R-2.IR_full       481 AGTGGCCATGGTCAAGGAANNC 502
                           |||||||||||||||||||  | silico     481 AGTGGCCATGGTCAAGGAAGCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137024.2  CG10814-RA (CG10814), mRNA 
0   NM_132113.2  CG3184-RA (CG3184), mRNA 
0   NM_130479.2  CG13377-RA (CG13377), mRNA 
0   NM_132539.2  CG1559-RA (Upf1), mRNA 
0   NM_176358.1  CG9614-RL, transcript variant L (pip), mRNA 
0   NM_176357.1  CG9614-RE, transcript variant E (pip), mRNA 
0   NM_057982.3  CG2819-RA (Pph13), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_167298.1  CG2446-RA, transcript variant A (CG2446), mRNA 
0   NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
0   NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
0   NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
0   NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
0   NM_167687.1  CG11943-RB, transcript variant B (CG11943), mRNA 
0   NM_134518.2  CG11943-RA, transcript variant A (CG11943), mRNA 
0   NM_080305.2  CG10755-RA (Cyp4ae1), mRNA 
0   NM_136485.2  CG30377-RA (CG30377), mRNA 
0   NM_170189.1  CG31115-RA (CG31115), mRNA 
0   NM_176293.1  CG33171-RC, transcript variant C (CG33171), mRNA 
0   NM_176294.2  CG33171-RE, transcript variant E (CG33171), mRNA 
0   NM_130627.2  CG3630-RA (CG3630), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_135997.1  CG18563-RA (CG18563), mRNA 
0   NM_139994.1  CG6486-RA (CG6486), mRNA 
0   NM_079480.2  CG7619-RA (Pros54), mRNA 
0   NM_164778.1  CG7356-RB, transcript variant B (CG7356), mRNA 
0   NM_135330.1  CG7356-RA, transcript variant A (CG7356), mRNA 
0   NM_143242.2  CG6420-RA (CG6420), mRNA 
0   NM_132739.1  CG5321-RA (CG5321), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.