National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10800R-2 
 Symbol Rca1  Full Name Regulator of cyclin A1 
 CG No CG10800  Old CG No CG10800 
 Synonyms 152549_at, rca1, CG10800, P3300, S(rux)2A, l(2)03300, Rca1 
 Accession No (Link to NCBI) NM_057866.2 
 Inserted Chr.
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zielke N, Querings S, Rottig C, Lehner C, Sprenger F.
The anaphase-promoting complex/cyclosome (APC/C) is required for rereplication control in endoreplication cycles.
Genes Dev. (2008) 22(12) 1690-703 [ PubMed ID = 18559483 ] [ RRC reference ]

Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGAGGGTCATCCTTCGAGTT 
 Primer Seq. 3'
aatctagaggtaccTCATCACGTCCAGCGTGTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGAGGGTCA TCCTTCGAGT TGGAGATGAA CGAGTCTGGC TACACATCCT TCCTGGCGCT 
0061 GCACAATTCC ACCGCGGAGA CGCCATTTTT ATTGGAGGAC GCTGAGGGCG AAAACTGTCG 
0121 CAATGCATCG AATACCACAA CATTCTTTCG GGGGCTGAAC ACGCCCAGTG GCCACCAGGA 
0181 GCAGGACCTT TACTGGGGCA AGCCCNTATC CCAGAACACA GCCCCAAAAG AAATTTTCCG 
0241 CGGAGGAGGA GCCTTTCTCT ATGACTCCGC GTCTGCAGGA TGAGCATAGT CTGCCCAAGC 
0301 GACGCAAGAA ACACTTTCAA TCGCCACACA GTAGCCCCAA GAAGTCCAAA AAGCTGCTCT 
0361 TTCCCCACAT AGAAGAACCG CCCAAGAATC GCTTCTACGG CGGTGTCGAA AAGCTGGACA 
0421 TCGTGGCCAA GCTGGCGCAA TGGCAACCGG CACTGCAGTg CATACTGCGT CATGTGGGCG 
0481 CCCACACGCT GGACGTGATG A 
 in silico PCR Fragment
0001 CCGAGGGTCA TCCTTCGAGT TGGAGATGAA CGAGTCTGGC TACACATCCT TCCTGGCGCT 
0061 GCACAATTCC ACCGCGGAGA CGCCATTTTT ATTGGAGGAC GCTGAGGGCG AAAACTGTCG 
0121 CAATGCATCG AATACCACAA CATTCTTTCG GGGGCTGAAC ACGCCCAGTG GCCACCAGGA 
0181 GCAGGACCTT TACTGGGGCA AGCCC-TATC CCAGAACACA GCCCCAAAAG AAATTTTCCG 
0241 CGGAGGAGGA GCCTTTCTCT ATGACTCCGC GTCTGCAGGA TGAGCATAGT CTGCCCAAGC 
0301 GACGCAAGAA ACACTTTCAA TCGCCACACA GTAGCCCCAA GAAGTCCAAA AAGCTGCTCT 
0361 TTCCCCACAT AGAAGAACCG CCCAAGAATC GCTTCTACGG CGGTGTCGAA AAGCTGGATA 
0421 TCGTGGCCAA GCTGGCGCAA TGGCAACCGG CACTGCAGTG CATACTGCGT CATGTGGGCG 
0481 CCCACACGCT GGACGTGATG A 
 Assemble Data

10800R-2.IR_full       1   CCGAGGGTCATCCTTCGAGTTGGAGATGAACGAGTCTGGCTACACATCCTTCCTGGCGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     1   CCGAGGGTCATCCTTCGAGTTGGAGATGAACGAGTCTGGCTACACATCCTTCCTGGCGCT 60


10800R-2.IR_full       61  GCACAATTCCACCGCGGAGACGCCATTTTTATTGGAGGACGCTGAGGGCGAAAACTGTCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     61  GCACAATTCCACCGCGGAGACGCCATTTTTATTGGAGGACGCTGAGGGCGAAAACTGTCG 120


10800R-2.IR_full       121 CAATGCATCGAATACCACAACATTCTTTCGGGGGCTGAACACGCCCAGTGGCCACCAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     121 CAATGCATCGAATACCACAACATTCTTTCGGGGGCTGAACACGCCCAGTGGCCACCAGGA 180


10800R-2.IR_full       181 GCAGGACCTTTACTGGGGCAAGCCCNTATCCCAGAACACAGCCCCAAAAGAAATTTTCCG 240
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
10800R-2.in silico     181 GCAGGACCTTTACTGGGGCAAGCCC-TATCCCAGAACACAGCCCCAAAAGAAATTTTCCG 240


10800R-2.IR_full       241 CGGAGGAGGAGCCTTTCTCTATGACTCCGCGTCTGCAGGATGAGCATAGTCTGCCCAAGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     241 CGGAGGAGGAGCCTTTCTCTATGACTCCGCGTCTGCAGGATGAGCATAGTCTGCCCAAGC 300


10800R-2.IR_full       301 GACGCAAGAAACACTTTCAATCGCCACACAGTAGCCCCAAGAAGTCCAAAAAGCTGCTCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     301 GACGCAAGAAACACTTTCAATCGCCACACAGTAGCCCCAAGAAGTCCAAAAAGCTGCTCT 360


10800R-2.IR_full       361 TTCCCCACATAGAAGAACCGCCCAAGAATCGCTTCTACGGCGGTGTCGAAAAGCTGGACA 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
10800R-2.in silico     361 TTCCCCACATAGAAGAACCGCCCAAGAATCGCTTCTACGGCGGTGTCGAAAAGCTGGATA 420


10800R-2.IR_full       421 TCGTGGCCAAGCTGGCGCAATGGCAACCGGCACTGCAGTGCATACTGCGTCATGTGGGCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10800R-2.in silico     421 TCGTGGCCAAGCTGGCGCAATGGCAACCGGCACTGCAGTGCATACTGCGTCATGTGGGCG 480


10800R-2.IR_full       481 CCCACACGCTGGACGTGATGA 501
                           |||||||||||||||||||||
10800R-2.in silico     481 CCCACACGCTGGACGTGATGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057866.2  CG10800-RA (Rca1), mRNA 
0   NM_136553.2  CG8639-RA (Cirl), mRNA 
0   NM_079357.2  CG7250-RA (Toll-6), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   13  NM_132539.2  CG1559-RA (Upf1), mRNA 
0   NM_057740.3  CG1912-RA (Gycalpha99B), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_132633.2  CG4332-RA (CG4332), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_132903.1  CG9906-RA (CG9906), mRNA 
0   NM_176234.1  CG33041-RA (CG33041), mRNA 
0   NM_142103.1  CG14846-RA (CG14846), mRNA 
0   NM_137992.1  CG5549-RA (CG5549), mRNA 
0   NM_132012.1  CG15776-RA (CG15776), mRNA 
0   NR_002088.1  CG15776-RA (CG15776), mRNA, mRNA 
0   NM_132850.2  CG8995-RA (PGRP-LE), mRNA 
0   NM_142043.1  CG9637-RA (Task6), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_132040.1  CG15766-RA (CG15766), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_132692.2  CG10992-RA (CG10992), mRNA 
0   NM_137339.2  CG9646-RA (CG9646), mRNA 
0   NM_141108.1  CG7414-RA (CG7414), mRNA 
0   NM_143480.2  CG18041-RA (CG18041), mRNA 
0   NM_141378.2  CG1155-RA (Osi14), mRNA 
0   NM_139436.1  CG15822-RC (CG15822), mRNA 
0   NM_078729.2  CG12193-RA (Or22a), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.