National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10792R-1 
 Symbol dnc  Full Name dunce 
 CG No CG32498  Old CG No CG10792 
 Synonyms CG32498, PDE4, CG10797, CG10791, EG:140G11.4, EG:96G10.7, fs(1)M42, EG:BACN05I09.3, EG:BACN5I9.2, CG14267, CG14268, CG10792, dnc 
 Accession No (Link to NCBI) NM_166968.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Murmu MS, Martin JR.
Interaction between cAMP and intracellular Ca(2+)-signaling pathways during odor-perception and adaptation in Drosophila.
Biochim. Biophys. Acta (2016) 1863(9) 2156-74 [ PubMed ID = 27212269 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTTATTCGCGCCTTTCCGTG 
 Primer Seq. 3'
aatctagaggtaccCGTAGGTCTGATCCTCATCGT 
 Predicted Fragment Size
551 
 IR fragment full Seq
0001 ATTTATTCGC GCCTTTCCGT GGAGCAGAAA ACGAGGTCGT NCCTGCCTTG GCCTTGACCC 
0061 TGATGCCCGA AGGCGGTGAG GATCATCGCG GCGATCTGAA TCAAAAGGGT GAGAATAACA 
0121 ATCGGCCGAG ACCCTCGATT TCGTTGGCCA ACAACGGCGA GGCAATGGCG CCGAGNAACT 
0181 CGTCGAAAAT CATCGAAATT CCATGAGGTC ACCTTCAGTG GCAGCGTTGG CGGTGGCGNA 
0241 CAGCGATGGT GGCGGCGAGG CCATCAATGG TGGTAACCTC GATGTAAGCC CCAGCAAACG 
0301 ACACTCCTTG AGCACCACCA CAAGCAACTC CAGCTCGGCA CCGTATCGAT ATCTGAGTGG 
0361 TAGCAGTAGA TCCCGGGGCT CTCGAGGCGA TTGCCACGAA TACTATCAAC TGCAACAGCA 
0421 TTCGTCGTCC CTATCGAATG GAAATCGTGG AAATCGTGGA CTAAGCCAGA GAAGCGATAC 
0481 AATGGCCACT GAGGCGGAGG GCGAGGAATT CGATGTGGAT CCCATGGACG AGGACGATGA 
0541 GGATCAGACC TACG 
 in silico PCR Fragment
0001 ATTTATTCGC GCCTTTCCGT GGAGCAGAAA ACGAGGTCGT -CCTGCCTTG GCCTTGACCC 
0061 TGATGCCCGA AGGCGGTGAG GATCATCGCG GCGATCTGAA TCAAAAGGGT GAGAATAACA 
0121 ATCGGCCGAG ACCCTCGATT TCGTTGGCCA ACAACGGCGA GGCAATGGCG CCGAG-AACT 
0181 CGTCGAAAAT CATCGAAATT CCATGAGGTC ACCTTCAGTG GCAGCGTTGG CGGTGGCG-A 
0241 CAGCGATGGT GGCGGCGAGG CCATCAATGG TGGTAACCTC GATGTAAGCC CCAGCAAACG 
0301 ACACTCCTTG AGCACCACCA CAAGCAACTC CAGCTCGGCA CCGTATCGAT ATCTGAGTGG 
0361 TAGCAGTAGA TCCCGGGGCT CTCGAGGCGA TTGCCACGAA TACTATCAAC TGCAACAGCA 
0421 TTCGTCGTCC CTATCGAATG GAAATCGTGG AAATCGTGGA CTAAGCCAGA GAAGCGATAC 
0481 AATGGCCACT GAGGCGGAGG GCGAGGAATT CGATGTGGAT CCCATGGACG AGGACGATGA 
0541 GGATCAGACC TACG 
 Assemble Data

10792R-1.IR_full       1   ATTTATTCGCGCCTTTCCGTGGAGCAGAAAACGAGGTCGTNCCTGCCTTGGCCTTGACCC 60
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
10792R-1.in silico     1   ATTTATTCGCGCCTTTCCGTGGAGCAGAAAACGAGGTCGT-CCTGCCTTGGCCTTGACCC 60


10792R-1.IR_full       61  TGATGCCCGAAGGCGGTGAGGATCATCGCGGCGATCTGAATCAAAAGGGTGAGAATAACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     61  TGATGCCCGAAGGCGGTGAGGATCATCGCGGCGATCTGAATCAAAAGGGTGAGAATAACA 120


10792R-1.IR_full       121 ATCGGCCGAGACCCTCGATTTCGTTGGCCAACAACGGCGAGGCAATGGCGCCGAGNAACT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10792R-1.in silico     121 ATCGGCCGAGACCCTCGATTTCGTTGGCCAACAACGGCGAGGCAATGGCGCCGAG-AACT 180


10792R-1.IR_full       181 CGTCGAAAATCATCGAAATTCCATGAGGTCACCTTCAGTGGCAGCGTTGGCGGTGGCGNA 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
10792R-1.in silico     181 CGTCGAAAATCATCGAAATTCCATGAGGTCACCTTCAGTGGCAGCGTTGGCGGTGGCG-A 240


10792R-1.IR_full       241 CAGCGATGGTGGCGGCGAGGCCATCAATGGTGGTAACCTCGATGTAAGCCCCAGCAAACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     241 CAGCGATGGTGGCGGCGAGGCCATCAATGGTGGTAACCTCGATGTAAGCCCCAGCAAACG 300


10792R-1.IR_full       301 ACACTCCTTGAGCACCACCACAAGCAACTCCAGCTCGGCACCGTATCGATATCTGAGTGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     301 ACACTCCTTGAGCACCACCACAAGCAACTCCAGCTCGGCACCGTATCGATATCTGAGTGG 360


10792R-1.IR_full       361 TAGCAGTAGATCCCGGGGCTCTCGAGGCGATTGCCACGAATACTATCAACTGCAACAGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     361 TAGCAGTAGATCCCGGGGCTCTCGAGGCGATTGCCACGAATACTATCAACTGCAACAGCA 420


10792R-1.IR_full       421 TTCGTCGTCCCTATCGAATGGAAATCGTGGAAATCGTGGACTAAGCCAGAGAAGCGATAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     421 TTCGTCGTCCCTATCGAATGGAAATCGTGGAAATCGTGGACTAAGCCAGAGAAGCGATAC 480


10792R-1.IR_full       481 AATGGCCACTGAGGCGGAGGGCGAGGAATTCGATGTGGATCCCATGGACGAGGACGATGA 540
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10792R-1.in silico     481 AATGGCCACTGAGGCGGAGGGCGAGGAATTCGATGTGGATCCCATGGACGAGGACGATGA 540


10792R-1.IR_full       541 GGATCAGACCTACG 554
                           ||||||||||||||
10792R-1.in silico     541 GGATCAGACCTACG 554

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   533  NM_166968.1  CG32498-RN, transcript variant N (dnc), mRNA 
11.25   60  NM_166970.1  CG32498-RG, transcript variant G (dnc), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_166221.2  CG10938-RA, transcript variant A (ProsMA5), mRNA 
0   NM_057854.3  CG10938-RB, transcript variant B (ProsMA5), mRNA 
0   NM_140381.1  CG14110-RA (CG14110), mRNA 
0   15  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_132458.2  CG16916-RA (Rpt3), mRNA 
0   10  NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_140023.2  CG5093-RA (Doc3), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_166042.1  CG8485-RC, transcript variant C (CG8485), mRNA 
0   NM_166041.1  CG8485-RB, transcript variant B (CG8485), mRNA 
0   NM_166043.1  CG8485-RD, transcript variant D (CG8485), mRNA 
0   NM_137098.2  CG8485-RA, transcript variant A (CG8485), mRNA 
0   NM_135202.2  CG11015-RA (CG11015), mRNA 
0   NM_141953.1  CG18554-RA (CG18554), mRNA 
0   10  NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0   10  NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0   13  NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_134887.2  CG9641-RA, transcript variant A (CG9641), mRNA 
0   NM_164518.1  CG9641-RB, transcript variant B (CG9641), mRNA 
0   NM_143226.1  CG5467-RA (CG5467), mRNA 
0   NM_166881.1  CG32813-RE, transcript variant E (CG32813), mRNA 
0   NM_138225.2  CG13907-RA (CG13907), mRNA 
0   NM_166883.1  CG32813-RF, transcript variant F (CG32813), mRNA 
0   NM_130553.2  CG32813-RA, transcript variant A (CG32813), mRNA 
0   NM_166882.1  CG32813-RC, transcript variant C (CG32813), mRNA 
0   NM_166884.2  CG32813-RB, transcript variant B (CG32813), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.