National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10777R-4 
 Symbol CG10777  Full Name CG10777 
 CG No CG10777  Old CG No CG10777 
 Synonyms DmRH1, cg10777, CG10777 
 Accession No (Link to NCBI) NM_132196.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     1   GGAAGCATGCACTTTGGTCAGCCCTATGGCGT-GATGACCTATGGCATCCAGAATGGTCT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGGAATGGGAGCCGCCGGTTCTGGTGGCGGCAATCCGTATCGCCAGCAAAACGGTGTTGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATTCGCCGGTAATGGACTTGGAGGAGGCGCCGGTGGCGGATCCGGAGGATCTGGCGGATA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGAGGACAGCGTGGCAAAAATCCAACCTACGCACAGCGTTATCAGAAGCCGAACAACGG 240

                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     241 CGCCGGAGTTGCTGGTGGCTACCAAAGCAATAACTACA-ATGCTGCCGCCTTAGGCATGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTTCCAAAGAGGAGCGCGCCGAGATCCAACGTGAAAAGGCCAAAAATCCCGGCCGAAATT 360

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     361 TAGTGAAACCCAAGTGGG-AGAACCTCGAGCCCTTCCTCAAAGATTTCTACAACATTCAT 420

                           |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     421 CCGAATACACTGGCCAAATCAGAGCAGCAGGTGGCCGAGATCCGGCGCGAACTGGAAATC 480

10777R-4.IR_full       481 ACCGTGTCTGGCAATGAACTACC 503
                           ||||||||||||||||||||||| silico     481 ACCGTGTCTGGCAATGAACTACC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132196.2  CG10777-RB (CG10777), mRNA 
0.62   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0.62   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0.62   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0.62   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0.62   NM_206168.2  CG8201-RO, transcript variant O (par-1), mRNA 
0.62   NM_206169.2  CG8201-RJ, transcript variant J (par-1), mRNA 
0.62   NM_206170.2  CG8201-RI, transcript variant I (par-1), mRNA 
0.62   NM_206171.2  CG8201-RH, transcript variant H (par-1), mRNA 
0.62   NM_001014540.1  CG8201-RN, transcript variant N (par-1), mRNA 
0.62   NM_001014542.1  CG8201-RL, transcript variant L (par-1), mRNA 
0.62   NM_206178.1  CG8201-RA, transcript variant A (par-1), mRNA 
0.62   NM_206177.1  CG8201-RB, transcript variant B (par-1), mRNA 
0.62   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0.62   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_001031944.1  CG4460-RA, transcript variant A (Hsp22), mRNA 
0   NM_001031945.1  CG4456-RB, transcript variant B (Hsp67Bb), mRNA 
0   NM_001031943.1  CG4460-RB, transcript variant B (Hsp22), mRNA 
0   10  42  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_206095.1  CG13214-RB, transcript variant B (CG13214), mRNA 
0   NM_078819.4  CG14916-RA (Gr32a), mRNA 
0   13  21  NM_142379.3  CG14329-RA (CG14329), mRNA 
0   NM_167644.1  CG32536-RA (CG32536), mRNA 
0   NM_136633.2  CG2072-RA (TXBP181-like), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   10  NM_136997.1  CG15870-RA (CG15870), mRNA 
0   NM_142537.1  CG3773-RA (CG3773), mRNA 
0   NM_130709.1  CG14271-RB (Gas8), mRNA 
0   NM_079053.2  CG4921-RB, transcript variant B (Rab4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.