National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10776R-2 
 Symbol wit  Full Name wishful thinking 
 CG No CG10776  Old CG No CG10776 
 Synonyms CG10776, STK-D, ALK3/BMPRII, l(3)64Aa, 1262/15, SE20, l(3)SH12, l(3)S126215, Stk-D, wit, Wit 
 Accession No (Link to NCBI) NM_079953.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGTTCCCAATCGCCAGTAT 
 Primer Seq. 3'
aatctagaggtaccCCGATTGTGAGGGCTGTGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGtTCCCA ATCGCCAGTA TAGCTGTATG AGCTACCAGG AGGACGACAA CTCATTTCAC 
0061 GATGATGATG GCGATCAGGA CTCTAGTGGC GAGCTGCAGG AGCNAGCAGG TGGAGTCCAC 
0121 TCCGATTCCG AGCGAGCCAC ATAGACGCAC CTGCCCAGAT GGCNTACACN TTTCTGTTTC 
0181 ACCATCTGGA ACCAGACGGC CAATGGAGCG CGGGTTGTTA AACAGGGTTG CTGGAAGGAC 
0241 AACACGGATC GCACTTCCAT TTGCAGCCAG TCGGAATGTA CCAGCTCGGC TCCCACCTCG 
0301 AAGACCAGTT CTTTGTACTA CTGTTGCTGT TCGGGAGGAG TGTNCAATGC CCAATATTCC 
0361 GTGGTCGAAC CGGCACCTCT GGAACTGGGC TCCAATGAGG GACGGACTTC GATCACAAAT 
0421 CGGGCGACAG AAAAACAGCA CCAGTCCTTT TTGGCCAGTA CAATGCTGGG NCTTGCCGGT 
0481 GGACTCACAG CCCTCACAAT CGG 
 in silico PCR Fragment
0001 CCTGTTCCCA ATCGCCAGTA TAGCTGTATG AGCTACCAGG AGGACGACAA CTCATTTCAC 
0061 GATGATGATG GCGATCAGGA CTCTAGTGGC GAGCTGCAGG AGC-AGCAGG TGGAGTCCAC 
0121 TCCGATTCCG AGCGAGCCAC ATAGACGCAC CTGCCCAGAT GGC-TACAC- TTTCTGTTTC 
0181 ACCATCTGGA ACCAGACGGC CAATGGAGCG CGGGTTGTTA AACAGGGTTG CTGGAAGGAC 
0241 AACACGGATC GCACTTCCAT TTGCAGCCAG TCGGAATGTA CCAGCTCGGC TCCCACCTCG 
0301 AAGACCAGTT CTTTGTACTA CTGTTGCTGT TCGGGAGGAG TGTGCAATGC CCAATATTCC 
0361 GTGGTCGAAC CGGCACCTCT GGAACTGGGC TCCAATGAGG GACGGACTTC GATCACAAAT 
0421 CGGGCGACAG AAAAACAGCA CCAGTCCTTT TTGGCCAGTA CAATGCTGGG CCTTGCCGGT 
0481 GGACTCACAG CCCTCACAAT CGG 
 Assemble Data

10776R-2.IR_full       1   CCTGTTCCCAATCGCCAGTATAGCTGTATGAGCTACCAGGAGGACGACAACTCATTTCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10776R-2.in silico     1   CCTGTTCCCAATCGCCAGTATAGCTGTATGAGCTACCAGGAGGACGACAACTCATTTCAC 60


10776R-2.IR_full       61  GATGATGATGGCGATCAGGACTCTAGTGGCGAGCTGCAGGAGCNAGCAGGTGGAGTCCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
10776R-2.in silico     61  GATGATGATGGCGATCAGGACTCTAGTGGCGAGCTGCAGGAGC-AGCAGGTGGAGTCCAC 120


10776R-2.IR_full       121 TCCGATTCCGAGCGAGCCACATAGACGCACCTGCCCAGATGGCNTACACNTTTCTGTTTC 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||
10776R-2.in silico     121 TCCGATTCCGAGCGAGCCACATAGACGCACCTGCCCAGATGGC-TACAC-TTTCTGTTTC 180


10776R-2.IR_full       181 ACCATCTGGAACCAGACGGCCAATGGAGCGCGGGTTGTTAAACAGGGTTGCTGGAAGGAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10776R-2.in silico     181 ACCATCTGGAACCAGACGGCCAATGGAGCGCGGGTTGTTAAACAGGGTTGCTGGAAGGAC 240


10776R-2.IR_full       241 AACACGGATCGCACTTCCATTTGCAGCCAGTCGGAATGTACCAGCTCGGCTCCCACCTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10776R-2.in silico     241 AACACGGATCGCACTTCCATTTGCAGCCAGTCGGAATGTACCAGCTCGGCTCCCACCTCG 300


10776R-2.IR_full       301 AAGACCAGTTCTTTGTACTACTGTTGCTGTTCGGGAGGAGTGTNCAATGCCCAATATTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
10776R-2.in silico     301 AAGACCAGTTCTTTGTACTACTGTTGCTGTTCGGGAGGAGTGTGCAATGCCCAATATTCC 360


10776R-2.IR_full       361 GTGGTCGAACCGGCACCTCTGGAACTGGGCTCCAATGAGGGACGGACTTCGATCACAAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10776R-2.in silico     361 GTGGTCGAACCGGCACCTCTGGAACTGGGCTCCAATGAGGGACGGACTTCGATCACAAAT 420


10776R-2.IR_full       421 CGGGCGACAGAAAAACAGCACCAGTCCTTTTTGGCCAGTACAATGCTGGGNCTTGCCGGT 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
10776R-2.in silico     421 CGGGCGACAGAAAAACAGCACCAGTCCTTTTTGGCCAGTACAATGCTGGGCCTTGCCGGT 480


10776R-2.IR_full       481 GGACTCACAGCCCTCACAATCGG 503
                           |||||||||||||||||||||||
10776R-2.in silico     481 GGACTCACAGCCCTCACAATCGG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_078945.2  CG2346-RA (Fmrf), mRNA 
0   20  NM_164401.3  CG31795-RB, transcript variant B (ia2), mRNA 
0   19  NM_134718.4  CG31795-RA, transcript variant A (ia2), mRNA 
0   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0   NM_078605.1  CG6211-RA (gce), mRNA 
0   NM_169533.1  CG9412-RA, transcript variant A (rin), mRNA 
0   NM_080168.2  CG9412-RB, transcript variant B (rin), mRNA 
0   NM_169531.1  CG9412-RD, transcript variant D (rin), mRNA 
0   NM_169532.1  CG9412-RE, transcript variant E (rin), mRNA 
0   NM_169530.1  CG9412-RC, transcript variant C (rin), mRNA 
0   NM_140984.1  CG5104-RB (CG5104), mRNA 
0   12  NM_165086.1  CG15288-RB, transcript variant B (wb), mRNA 
0   12  NM_057442.3  CG15288-RA, transcript variant A (wb), mRNA 
0   NM_133133.1  CG7990-RA, transcript variant A (CG7990), mRNA 
0   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_136794.1  CG13231-RA (CG13231), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_140050.2  CG4022-RA (CG4022), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_078637.2  CG9209-RB, transcript variant B (vap), mRNA 
0   15  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_132667.1  CG15756-RA (CG15756), mRNA 
0   10  NM_132131.2  CG14435-RA (CG14435), mRNA 
0   NM_166516.1  CG11170-RB (CG11170), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.